Association between TGFβ1 polymorphisms and chronic hepatitis B infection in an Iranian population

Abstract

INTRODUCTION:

Transforming growth factor-beta 1 (TGFβ1) is a potent suppressive cytokine that contributes to chronic hepatitis B (CHB) infection. Disparities in TGFβ1 production among individuals have been attributed to TGFβ1 genetic polymorphisms. We examined whether three putative polymorphisms in TGFβ1[-509 C/T (rs1800469), +869 C/T (rs1800470), and +11929 C/T (rs1800472)]are associated with CHB infection in a South-Eastern Iranian population.

METHODS:

In total, 341 subjects were recruited, including 178 patients with CHB and 163 healthy individuals as controls. Genotyping of the three TGFβ1 SNPs was performed by tetra amplification refractory mutation system-PCR.

RESULTS:

TheTGFβ1 +869 TT vs.CC genotype in codominant (OR=0.445, p=0.012) and TT vs. TC+CC in the recessive (OR=0.439, p=0.003) model as well as the variant allele T vs. C(OR=0.714, p=0.038) were associated with lower CHB infection risk. However, the +11929 C/T polymorphism was associated with increased CHB risk, and the CT vs. CC genotype (OR=2.77, P=0.001) and T variant allele (OR=2.53, P=0.002) were risk factors for CHB. Furthermore, TTT (+869/-509/+11929) and CCC haplotypes were risk and protective factors for CHB, respectively. We found no significant association between viral DNA load and TGFβ1 genotype or hepatic enzyme levels (p >0.05).

CONCLUSIONS:

Results indicated that the TGFβ1+869TT genotype and T allele were protective factors, whereas the +11929 CT genotype and T allele were risk factors for CHB infection.

Keywords:
Chronic hepatitis B infection; Gene polymorphism; TGFβ1

INTRODUCTION

Hepatitis B virus (HBV) is the most frequent cause of acute and chronic liver disease worldwide. HBV infects more than 350 million people globally, especially in developing countries of Asia and Africa. Over 90% of adult onset infections are resolved within 6 months, with or without clinical symptoms. However, 5-10% of cases develop into persistent infections, which are defined as chronic hepatitis B (CHB);these can present as more severe forms such as liver cirrhosis and hepatocellular carcinoma. The risk of HBV persistence is related to two main factors: host immunological¹, and genetic².

Many studies have suggested that cytokines are critical for the development of a proper immune response against HBV, to eradicate the viral infection, and control hepatitis B-associated complications including cirrhosis of the liver and hepatocellular carcinoma (HCC). Transforming growth factor-beta 1 (TGFβ1) is a potent suppressive cytokine involved in the cellular immune response, and is also important for various physiological processes in the liver, as it promotes apoptosis and inhibits hepatocyte proliferation in addition to its crucial role in hepatic fibrogenesis³. This molecule is produced by a number of cell types, including monocytes, macrophages, endothelial cells, and vascular smooth muscle cells and is also released from a variety of liver cells, including hepatocytes and hepatic stellate cells (HSC) in addition to platelets and infiltrating mononuclear cells⁴. Compared to healthy subjects, CHB patients have been shown to express higher levels of serum TGFβ1, resulting in dysregulation of the host immune response^5,6. As a multifunctional cytokine, TGFβ1 hinders the propagation, differentiation, and activation of immune cells, and plays key roles in the regulation of viral replication and host responses to pathogens⁷.

Growing evidence suggests that genetic variations in immune-related genes such as TGFβ1 are associated with CHB risk or progression ^4,8,9. Host genetic background, particularly single nucleotide polymorphisms (SNPs), have been shown to be a crucial factor for associated clinical heterogeneity¹⁰. TGFβ is encoded by three different genes, namely TGFβ1, TGFβ2, and TGFβ3. Human TGFβ1 is located on chromosome 19q13.1 and variation among individuals in terms of TGFβ1 production is considered to be genetically controlled⁸.

Three putative polymorphisms of TGFβ1include a C/T transition at the -509 position of the promoter region, a+869 T/C transition in codon 10 of exon 1, and the +11929C/T polymorphism in exon 5. Recent studies have shown that the T allele of the -509C/T (rs1800469) variation is associated with high production of TGFβ1and a lower risk of CHB^11,12.Additionally, the exon 1 SNP +869C/T (rs1800470)located at position 29 involves an amino acid change of proline to leucine at position 10 of the signal peptide ofTGFβ1¹³. Another SNP, +11929C/T (rs1800472) in exon 5, results in the amino acid replacement of Thr263Ile, and is related to the activation of TGFβ1¹⁴.

TGFβ1 polymorphisms have been evaluated in a number of infectious diseases, including Mycobacterium tuberculosis (TB) infection¹⁵, brucellosis^7,16, hepatitis C virus (HCV) infection^6,17, and CHB^5,18,19; however, results have been inconsistent. Considering solid evidence implicating TGFβ1 polymorphisms in infectious diseases, the current study was designed to investigate the potential relationships between three genetic polymorphisms inTGFβ1, including -509 C/T, +869C/T, and +11929C/T, and the risk of CHB in a South-East Iranian population. To the best of our knowledge, this is the first study examining TGFβ1 variations and CHB in this population.

METHODS

Study population

The current case-control study included 178 CHB patients (114 men and 64 women; age range 15-68 years and mean ± SD = 34.02 ± 10.1) and 163 healthy individuals as the control group (108 men and 55 women; age range 17-58 years and mean ± SD =33.84 ±23.2). Patients with CHB infection were recruited from blood transfusion organization outpatient clinics in Zahedan, during 2013-2015, and their ethnicity was Fars or Balouch. The research was executed at the Infectious Diseases and Tropical Medicine Research Center, Zahedan University of Medical Sciences, and the study was approved by the ethics committee of Zahedan University of Medical Sciences, Zahedan; all patients gave informed consent before taking part in the study.

Viral assessment and HBV DNA quantification

Chronic hepatitis B was determined as positivity for HBsAg for a minimum of 6 months. All patients were positive for hepatitis B surface antigen (HBsAg) and HBV-DNA and negative for HCV antibodies. The main exclusion criteria included human immunodeficiency virus or HCV co-infection, or any evidence of clinically relevant liver disease such as apparent auto-immune hepatitis-primary biliary cirrhosis, HCC, former history of alcohol abuse, or previous liver transplantation. HBsAg and HCV antibodies were tested using a commercial kit (Enzygnost, Germany). HBV-DNA in HBV-positive patients was extracted and tested by polymerase chain reaction (PCR) (Cinagen, Iran) and quantified by quantitative PCR (qPCR) (ABI 7800, Applied Biosystems, Foster City, CA). Patients were stratified into two groups according to their viral DNA loads²⁰. Group 1 included patients with low serum HBV DNA levels (<2,000IU/mL; n = 63) and group 2 included patients with high titers of HBV DNA (≥2,000IU/mL; n = 34).

The control group included healthy blood donors from the same geographic area and with the same ethnicity, who were anti-HBs- and anti-HBc-positive (resolved HBV) with no history of previous liver disease. There was no difference between groups regarding gender or ethnicity.

DNA isolation and genotyping of TGFβ1SNPs (-509 C/T, +869C/T, and +11929C/T)

Blood samples were collected by withdrawing5mL of venous blood into sterile EDTA-containing tubes. DNA was extracted by the salting-out method, as described previously^21,22. The isolated DNA was examined by electrophoresis using a 1% agarose gel, quantified spectrophotometrically, and stored at −20 °C until further use.

The threeTGFβ1polymorphisms, -509 C/T, +869C/T, and +11929C/T, were genotyped by the tetra-primer amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR) method, as described previously²³. T-ARMS-PCR utilizes four primers including two external primers (control band) and two inner primers (allele specific primers). This method simultaneously amplifies both alleles in one single PCR tube. The cycling conditions for T-ARMS-PCR were an initial denaturation at 95°C for 5 min followed by 30 cycles of 30s at 95°C, annealing for 30s at 60°C for -509 C/T, 30s at 65°C for +869C/T, and 30s at 63°C for +11929C/T, and a final cycle of 72°C for 10 min.

PCR products were separated by standard electrophoresis on a 2% agarose gel containing ethidium bromide. The primer sequences and products sizes are shown in Table 1.

TABLE 1
Primers used for genotyping of TGFβ1 gene polymorphisms and amplicon sizes.

SNPs	Name1	Primer sequence	Amplicons size (bp)
TGFβ1 SNPs
-509 C/T	FO	AGTAAATGTATGGGGTCGCAGGGTGTTG	295
	RO	AAAGAGGACCAGGCGGAGAAGGCTTAAT
	FI (T allele)	GGTGTCTGCCTCCTGACCCTTCCATACT	207
	RI (C allele)	GAGGAGGGGGCAACAGGACACCTTAG	141
+869 C/T	FO	CAGCTTTCCCTCGAGGCCCTCCTACCTT	255
	RO	TTCCGCTTCACCAGCTCCATGTCGATAG
	FI (T allele)	CTCCGGGCTGCGGCTGCTTCT	123
	RI (C allele)	AGTAGCCACAGCAGCGGTAGCAGCATCG	180
+11,929 C/T	FO	AGAGTGTGTGTGTATGTCCCCTATCCCC	313
	RO	AGACAGATGCTCAGCCCAAGCACAG
	FI (T allele)	GCCTTTCCTGCTTCTCATGGCAAC	143
	RI (C allele)	CTGGGCCCTCTCCAGCGTGA	213

• TGFβ1: transforming growth factor-beta 1; SNP: single nucleotide polymorphisms; bp: base-pair; FO: forward outer; RO: reverse outer; FI: forward inner; RI: reverse inner; Nucleotide specificity is shown in parentheses.

Statistical analysis

All statistical analyses were performed using SPSS software for Windows, version 18.0 (SPSS Inc, Chicago IL, USA). The association between genotypes and CHB was calculated by estimating the odds ratio (OR) and 95% confidence intervals (95% CI) based on logistic regression analyses. P-values below 0.05 were considered statistically significant. The Hardy-Weinberg equilibrium (HWE), differences in the distribution of the haplotype, and diplotype distributions between the two groups were assessed by the χ2 test. Linkage disequilibrium and frequencies of haplotypes and diplotypes in the controls and patients were calculated using SNPStats software²⁴.

RESULTS

Genotype frequencies of TGFβ1-509 C/T, +869C/T, and +11929C/T polymorphisms

ThreeTGFβ1 polymorphisms were successfully genotyped in CHB patients and control subjects. No SNPs had genotype frequencies that deviated significantly from the HWE in the studied control groups (p>0.05), except for the -509 C/T variation (p=0.01).The genotype and allele frequencies of thethreeTGFβ1gene polymorphisms in the studied groups are shown in Table 2.

TABLE 2
Genotype and allele frequencies of TGFβ1 SNPs between chronic hepatitis B virus (HBV)-infected patients and controls.

Genetic models	Allele/genotype	HBV patients	Controls	*OR (95% CI)	*P-value
		n(%)	n(%)
TGFβ1 +869 C/T
alleles	C	228 (58.0)	201 (51.0)	Ref.	-
	T	164 (42.0)	195 (49.0)	0.714 (0.559­-0.982)	0.038
codominant	CC	55 (28.0)	49 (25.0)	Ref.	-
	CT	118 (60.0)	103 (52.0)	1.021 (0.640-1.628)	0.932
	TT	23 (12.0)	46 (23.0)	0.445 (0.237-0.838)	0.012
dominant	CC	55 (28.0)	49 (25.0)	Ref.	-
	TC + TT	141 (72.0)	149 (75.0)	0.831 (0.538-1.320)	0.494
recessive	TC+CC	173 (88.0)	152 (77.0)	Ref.	-
	TT	23 (12.0)	46 (23.0)	0.439 (0.254-0.758)	0.003
GFβT1-509 C/T
alleles	C	234 (66.0)	196 (63.0)	Ref.	-
	T	122 (34.0)	112 (37.0)	0.912 (0.663-1.255)	0.625
codominant	CC	78 (44.0)	71 (46.0)	Ref.	-
	CT	78 (44.0)	54 (35.0)	1.315 (0.819-2.110)	0.257
	TT	22 (12.0)	29 (19.0)	0.691 (0.364-1.310)	0.256
dominant	CC	78 (44.0)	71 (46.0)	Ref.	-
	TC + TT	100 (56.0)	83 (54.0)	1.096 (0.711-1.162)	0.741
recessive	TC+CC	156 (88.0)	125 (81.0)	Ref.	-
	TT	22 (12.0)	29 (19.0)	1.645 (0.901-3.004)	0.127
TGFβ1+11929 C/T
alleles	C	299 (89.0)	310 (95.0)	Ref.	-
	T	39 (11.0)	16 (5.0)	2.527 (1.382-4.613)	0.002
codominant	CC	130 (77.0)	147 (90.0)	Ref.	-
	CT	39 (23.0)	16 (10.0)	2.765 (1.471-5.164)	0.001
	TT	0	0	-	-

• TGFβ1: transforming growth factor-beta 1; SNP: single nucleotide polymorphisms; HBV: hepatitis B virus; OR: odds ratio; CI: confidence interval; .*Adjusted for age and sex. OR.

TheTGFβ1+869 C/T polymorphism was associated with a decreased rate of CHB infection. The mutant homozygote genotype (TT vs. CC) was present at a significantly lower frequently in CHB patients than in controls (12% vs. 23%), and this was associated with reduced risk of CHB infection (OR=0.445, 95%CI=0.237-0.838, p=0.012). Likewise, at the allelic level, for TGFβ1+869, the variant allele T was less prevalent in CHB patients than in controls (42 vs. 49) and was a protective factor against CHB development (OR=0.714, 95%CI=0.559-0.982, p=0.038).

The TGFβ1+11929 C/T polymorphism was associated with increased susceptibility to CHB infection. The heterozygote genotype (CT vs. CC) was present significantly more frequently in CHB patients than in controls (23% vs. 10%), and it was a risk factor for CHB infection (OR=2.765, 95%CI=1.471-5.164, p=0.001). In addition, at the allelic level, for TGFβ1+11929,the variant allele T was more prevalent in CHB patients than in controls (11 vs. 5) and was found to be a risk factor forCHB development (OR=2,527, 95%CI=1,382-4,613, p=0.002) in our population.

With respect to other TGFβ1 SNPs, for -509 C/T, the genotypes and allele distributions did not significantly differ between patients and neither was associated with CHB risk (p>0.05).

Linkage disequilibrium and haplotype association analysis of TGFβ1polymorphisms

Linkage disequilibrium (LD) was computed by calculating Lewontin’s Delta' coefficient and the correlation coefficient, r²²⁵. Pairwise LD between the TGFβ1SNPs -509 C/T, +869C/T, and +11929C/T was calculated for cases and controls. Analysis of the TGFβ1 SNPs demonstrated a moderate LD for the TGFβ1 SNP pair, -509 C/T and +869 C/T (D' = 0.689 r²=0.315), but no LD was observed between other TGFβ1 SNP pairs, namely -509 C/T and +11929 (D' = 0.076, r²=0.001)or +869 C/T and +11929 C/T (D' = 0.021, r²=0.001). Table 3 shows haplotype association analyses for TGFβ1 polymorphisms in CHB patients and controls. The TTT and CCC haplotypes (+869/-509/+11929; p=0.003) were distributed differently in CHB patients compared to that in controls. The TTT haplotype was associated with an increased risk of CHB (OR=4.253, 95%CI=1.487-12.16, p=0.003), whereas the CCC haplotype was associated with a reduced risk of CHB (OR=0.655, 95%CI=0.448-0.957, p=0.028).Owing to the small number of subjects, the haplotype findings should be interpreted with caution. Meanwhile, we performed pairwise diplotype analysis among the three TGFβ1 SNPs but the results were not statistically significant (data not shown).

TABLE 3
Haplotype association analyses for TGFβ1 -509 C/T, +869C/T, and +11929C/T polymorphisms between chronic hepatitis B patients and controls.

Haplotype*	Case/Freq (%)	Control/Freq (%)	OR (95% CI)	P-value
TGFβ1 SNPs+869/-509/+11929
TTC	122 (12.0)	108 (0.43)	0.994 (0.706-1.400)	0.973
CCC	68 (0.2)	81 (0.3)	0.655 (0.448-0.957)	0.028
CCT	11 (0.03)	5 (0.02)	1.774 (0.617-5.104)	0.281
CTC	42 (0.15)	40 (0.16)	0.908 (0.567-1.455)	0.689
CTT	4 (0.01)	4 (0.14)	0.844 (0.187-3.813)	0.825
TCC	19 (0.06)	9 (0.03)	2.024 (0.890-4.605)	0.087
TCT	0.1 (0.0)	1 (0.01)	-	-
TTT	20 (1.0)	4 (0.02)	4.253 (1.487-12.16)	0.003

• TGFβ1: transforming growth factor-beta 1; SNP: single nucleotide polymorphisms; OR: odds ratio; CI: confidence interval.^*Haplotype analysis for frequencies below 0.01 was not performed. Bold numbers depict p < 0.05.

Table 4 demonstrates the stratification of hepatitis B patients, based on their viral DNA load, as well as the relationship between patient sex, age, and mean level of liver enzymes and TGFβ1 genotypes. We observed that TGFβ1 genotypes were distributed equally in two groups with high and low HBV DNA levels, and the difference was not statistically significant (P>0.05). However, HBV DNA levels were associated with mean patient age (P=0.001), but not with gender or liver enzyme levels (p>0.05).

TABLE 4
Stratification of hepatitis B patients based on viral DNA load, and relationships between patient sex, age, and mean level of liver enzymes and TGFβ1 genotypes.

Parameter	Patients with low HBV DNA levels (<2,000MU/mL)	Patients with high HBV DNA levels (>2,000MU/mL)	P-value
Sex (male/female)	20/15	46/18	0.137
Age (years)	31	41.5	0.001
ALT (IU/L)	29.7	27.4	0.441
AST (IU/L)	36.1	30.9	0.325
ALP (IU/L)	193.3	159.1	0.326
TGFβ1 +869 C/T
CC (%)	20 (32.0)	30 (31.0)	Ref.
CT (%)	36 (58.0)	55 (57.0)	0.995
TT (%)	6 (10.0)	11 (12.0)	0.781
TGFβ1 -509 T/C
CC (%)	28 (45.0)	14(40.0)	Ref.
CT (%)	28 (45.0)	14(40.0)	0.998
TT (%)	6 (10.0)	7(20.0)	0.315
TGFβ1 +11929C/T
CC (%)	44 (73.0)	26 (74.0)	Ref.
CT (%)	16 (27.0)	9 (26.0)	0.994

• DNA: deoxyribonucleic acid; TGFβ1: transforming growth factor-beta 1; HBV: hepatitis B virus; ALT: alanine aminotransferase; AST: aspartate transaminase; ALP: alkaline phosphatase; MU/mL: mili units/millilitre; IU:/L: international Units/liter.

Furthermore, we compared the relationships between the levels of hepatic enzymes (ALT, AST, and ALP) and different TGFβ1 genotypes (p>0.05) among the CHB patients. ANOVA analysis (Tukey test) of the genotypes indicated that there was no significant association between TGFβ1genotypes and the quantity of hepatic enzymes (P>0.05) (data not shown).

DISCUSSION

Growing evidence has suggested defective cellular and humoral immune functions in patients with CHB infection; this could be directly related to the chronicity of the disease²⁶. In general, patients with CHB infection have a weak, relatively unfocused intra-hepatic and systemic immune response to HBV antigens²⁷. Animal studies have shown an increase in the levels of TGFβ1 and TNF-α during hepatic fibrogenesis, and this contributes to fibrin matrix formation and liver fibrosis^28,29.

Our results showed that TGFβ1 +869 C/T and +11929 C/T polymorphisms were associated with lower and higher risk of CHB infection, respectively. The TGFβ1 +869 homozygote genotype (TT) might confer protection against CHB in the tested population. The carriers of the TT genotype had a comparatively (0.4-fold) lower risk of CHB than subjects with CC or CC+CT genotypes. Likewise, the TGFβ1 +869 T variant was associated with a reduced risk of CHB (OR=0.7).Concerning TGFβ1 +11929 C/T, we found that the CT genotype as well as the T allele were related to an increased risk of CHB. In addition, subjects harboring either the CT genotype or the T allele had a relatively (2.8- or 2.5-fold, respectively) increased risk of CHB in our population. Furthermore, the TTT (+869/-509/+11929) haplotype carriers had a 4.2-fold higher risk of CHB. However, the CCC (+869/-509/+11929) haplotype was shown to potentially confer protection against CHB in our population (OR=0.6).

Our data regarding the TGFβ1 +869 C/T polymorphism were similar to those of several studies on inflammatory and infectious diseases such as chronic periodontitis²³, Crohn's disease³⁰, childhood asthma³¹, multiple sclerosis (MS)³², and TB³³. Schrijver et al. reported that TGFB1 T+869C variation is associated with MS susceptibility, especially in males, and with a more destructive disease course³². However, the study by Ribeiro et al³⁴on CHB and the report of Mak et al³⁵on TB showed no relation between TGFβ1 gene polymorphisms and disease risk. Our findings regarding TGFβ1-509 C/T support the results of Hosseini Razavi et al. who found no association between the TGFβ1-509C/T polymorphism and CHB in an Iranian population. Compared to their study, our study is a population-based study performed on individuals from a South-Eastern Iranian population; however, their study was a hospital-based study performed using samples obtained from the Taleghani Hospital in Tehran, the capital city of Iran, and these samples were from individuals of a different ethnicity compared to that of our subjects⁵. Although both studies examined the effect of the TGFβ1-509C/T polymorphism on CHB, we also examined two other gene polymorphisms (+869 C/T and +11929 C/T),where were not included in the study of Hosseini Razavi et al⁵.

The 11929C/T SNP (Thr263Ile; rs1800472), located in exon 5, is close to the latency-associated peptide cleavage site, required to activate the protein. Hence, this SNP might affect the activation process of TGFβ1¹³. In support of this report, we previously found that the risk of CHB is higher among those with the high producer allele T (Ile) than in those with the C (Thr) allele¹². The +11929C/T SNP has been the basis of a number of studies; however, it was not shown to be associated with the risk of chronic periodontitis²³or childhood asthma³¹.

TGFβ1 is located on chromosome 19q13 and consists of 23,020 base pairs, including six introns and seven exons. TGFβ1exhibits bi-allelic polymorphisms at position -509C/T in the promoter region and two bi-allelic polymorphisms in exon 1 (+869C/T) and exon 5 (+11929C/T)²¹.The TGFβ1 +869 C/T substitution (rs1800470) results in a proline (CCG) to leucine (CTG) change at codon 10 (Pro10Leu) of the protein. This genetic alteration occurs in the signal peptide, which is involved in export of the pre-pro-protein across the endoplasmic reticulum membrane. The +869 Leu allele (T) has been shown to elevate the secretion of this cytokine in breast cancer³⁶, lung fibrosis³⁷, and schizophrenia³⁸.In contrast, some studies have reported that the Pro allele (C) of +869 C/T is related to higher serum levels, compared to those associated with the Lue (T) allele, in HCC patients¹². A transfection study using HeLa cells also indicated that the allele (C) encoding Pro 10 is associated with increased rates of TGFβ1 secretion³⁹. In agreement with the latter studies, our findings showed that the risk of CHB was lower among those with the lower producer genotype TT (Leu/Leu), when compared to that in individuals with the CC genotype¹². Dual roles of TGF-β in immune system regulation can explain the conflicting results; different studies have shown that TGF-β can have either positive or negative effects on hepatitis B infection.

TGFβ has dual roles in the regulation of the immune system. It induces the differentiation of Th17 cells, the main source of IL-17A,which is essential for both the initiation and maintenance of appropriate immune responses against microbes; in addition, it is involved in the development of cirrhosis of the liver and HCC^7,40,41,42. In contrast, it can increase the number and activation of T regulatory lymphocytes and the recruitment of these cells to the infected liver; this leads to prolonged hepatitis B infection. Prolonged infection with the chronic, asymptomatic, and occult forms of hepatitis B contributes to HCC and cirrhosis of the liver⁴³. The mechanisms responsible for the prolonged hepatitis B infection, HCC, and cirrhosis of the liver are not entirely understood.

Our study was a population-based study of South-Eastern Iranians. Similarly, Hosseini Razavi et al ⁵ examined the association between TGFβ1 +915G/C and -509C/T gene polymorphisms and CHB patients from Tehran, Iran. They observed no statically significant differences in terms of genotype distribution and allele frequency for both polymorphisms between healthy controls and patients with CHB. In another study (hospital-based) on HCV patients, Romani et al ⁴⁴ found no significant differences in terms of the allelic frequency distribution of SNPs at -509 C/T, +869 C/T, or +915 G/C between HCV patients and healthy controls. In contrast, the hospital-based study of Talaat et al ⁴ on 65 Egyptian hepatitis B patients and 50 healthy controls indicated that the T29C CC genotype might act as a host genetic factor of HBV susceptibility in Egyptians.

In conclusion, our findings suggest that theTGFβ1 +869 C/T and +11929 C/T polymorphisms are associated with a lower and higher risk of CHB infection, respectively, in a South-East Iranian population. Moreover, the TTT or CCC (+869/-509/+11929) haplotype carriers were at a higher or reduced risk of CHB, respectively. The main limitation of this study were that serum TGF-β1 levels were not measured was and data regarding population risk factors for HBV infection and identification of the actual population were missed. However, the advantage of our study was the large number of subjects and the fact that it was a population-based study. Further studies using larger sample size on different ethnicities are suggested to confirm out findings regarding the implication of theTGFβ1variants in CHB infection risk.

Acknowledgements

The authors appreciate all individuals who willingly participated in the current study.

REFERENCES

• ¹
  Zhang TC, Pan FM, Zhang LZ, Gao YF, Zhang ZH, Gao J, et al. A meta-analysis of the relation of polymorphism at sites -1082 and -592 of the IL-10 gene promoter with susceptibility and clearance to persistent hepatitis B virus infection in the Chinese population. Infection 2011;39(1):21-7.
• ²
  de Andrade JrDR, de Andrade DR. The influence of the human genome on chronic viral hepatitis outcome. Rev Inst Med Trop Sao Paulo. 2004;46(3):119-26.
• ³
  Karimi-Googheri M, Daneshvar H, Nosratabadi R, Zare-Bidaki M, Hassanshahi G, Ebrahim M, et al. Important roles played by TGF-beta in hepatitis B infection. J Med Virol. 2014;86(1):102-8.
• ⁴
  Talaat RM, Dondeti MF, El-Shenawy SZ, Khamiss OA. Transforming growth factor- beta 1 gene polymorphism (T29C) in Egyptian patients with hepatitis b virus infection: a preliminary study. Hepat Res Treat. 2013;2013:ID 293274.
• ⁵
  Hosseini Razavi A, Azimzadeh P, Mohebbi SR, Hosseini SM, Romani S, Khanyaghma M, et al. Lack of Association Between Transforming Growth Factor Beta 1 -509C/T and +915G/C Polymorphisms and Chronic Hepatitis B in Iranian Patients. Hepat Mon. 2014;14(4):e13100.
• ⁶
  Ma J, Liu YC, Fang Y, Cao Y, Liu ZL. TGF-beta1 polymorphism 509 C>T is associated with an increased risk for hepatocellular carcinoma in HCV-infected patients. Genet Mol Res. 2015;14(2):4461-8.
• ⁷
  Bravo MJ, Colmenero JD, Queipo-Ortuño MI, Alonso A, Caballero A. TGF-beta1 and IL-6 gene polymorphism in Spanish brucellosis patients. Cytokine. 2008;44(1):18-21.
• ⁸
  Qi P, Chen YM, Wang H, Fang M, Ji Q, Zhao YP, et al. -509C>T polymorphism in the TGF-beta1 gene promoter, impact on the hepatocellular carcinoma risk in Chinese patients with chronic hepatitis B virus infection. Cancer Immunol Immunother. 2009;58(9):1433-40.
• ⁹
  Xie HY, Wang WL, Yao MY, Yu SF, Feng XN, Jin J, et al. Polymorphisms in cytokine genes and their association with acute rejection and recurrence of hepatitis B in Chinese liver transplant recipients. Arch Med Res. 2008;39(4):420-8.
• ¹⁰
  Zhou J, Chen DQ, Poon VK, Zeng Y, Ng F, Lu L, et al. A regulatory polymorphism in interferon-gamma receptor 1 promoter is associated with the susceptibility to chronic hepatitis B virus infection. Immunogenetics. 2009;61(6):423-30.
• ¹¹
  Saxena R, Kaur J. Th1/Th2 cytokines and their genotypes as predictors of hepatitis B virus related hepatocellular carcinoma. World J Hepatol. 2015;7(11):1572-80.
• ¹²
  Kim YJ, Lee HS, Im JP, Min BH, Kim HD, Jeong JB, et al. Association of transforming growth factor-beta1 gene polymorphisms with a hepatocellular carcinoma risk in patients with chronic hepatitis B virus infection. Exp Mol Med. 2003;35(3):196-202.
• ¹³
  Koch W, Hoppmann P, Mueller JC, Schomig A, Kastrati A. Association of transforming growth factor-beta1 gene polymorphisms with myocardial infarction in patients with angiographically proven coronary heart disease. Arterioscler Thromb Vasc Biol. 2006;26(5):1114-9.
• ¹⁴
  Syrris P, Carter ND, Metcalfe JC, Kemp PR, Grainger DJ, Kaski JC, et al. Transforming growth factor-beta1 gene polymorphisms and coronary artery disease. Clin Sci (Lond) 1998;95(6):659-67.
• ¹⁵
  Amirzargar AA, Rezaei N, Jabbari H, Danesh AA, Khosravi F, Hajabdolbaghi M, et al. Cytokine single nucleotide polymorphisms in Iranian patients with pulmonary tuberculosis. Eur Cytokine Netw. 2006;17(2):84-9.
• ¹⁶
  Budak F, Goral G, Heper Y, Yilmaz E, Aymak F, Basturk B, et al. IL-10 and IL-6 gene polymorphisms as potential host susceptibility factors in Brucellosis. Cytokine. 2007;389(1):32-6.
• ¹⁷
  Gewaltig J, Mangasser-Stephan K, Gartung C, Biesterfeld S, Gressner AM. Association of polymorphisms of the transforming growth factor-beta1 gene with the rate of progression of HCV-induced liver fibrosis. Clin Chim Acta. 2002;316(1-2):83-94.
• ¹⁸
  Rafiei A, Hajilooi M, Shakib RJ, Alavi SA. Transforming growth factor-beta1 polymorphisms in patients with brucellosis: an association between codon 10 and 25 polymorphisms and brucellosis. Clin Microbiol Infect 2007;13(1):97-100.
• ¹⁹
  Karaoglan I, Pehlivan S, Namiduru M, Pehlivan M, Kilincarslan C, Balkan Y, et al. TNF-alpha, TGF-beta, IL-10, IL-6 and IFN-gamma gene polymorphisms as risk factors for brucellosis. New Microbiol 2009;32(2):173-8.
• ²⁰
  Lok AS, McMahon BJ. Chronic hepatitis B. Hepatology. 2007;45(2):507-39.
• ²¹
  Sepanjnia A, Eskandari-Nasab E, Moghadampour M, Tahmasebi A, Dahmardeh F. TGFbeta1 genetic variants are associated with an increased risk of acute brucellosis. Infect Dis (Lond). 2015;47(7):458-64.
• ²²
  Eskandari-Nasab E, Moghadampour M, Sepanj-Nia A. TNF-alpha -238, -308, -863 polymorphisms, and brucellosis infection. Hum Immunol. 2016;77(1):121-125.
• ²³
  Heidari Z, Mahmoudzadeh-Sagheb H, Rigi-Ladiz MA, Taheri M, Moazenni-Roodi A, Hashemi M. Association of TGF-beta1 -509 C/T, 29 C/T and 788 C/T gene polymorphisms with chronic periodontitis: a case-control study. Gene 2013;518(2):330-4.
• ²⁴
  Solé X, Guinó E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the analysis of association studies. Bioinformatics. 2006;22(15):1928-9.
• ²⁵
  Lewontin RC. The detection of linkage disequilibrium in molecular sequence data. Genetics. 1995;140(1):377-88.
• ²⁶
  Wang KX, Peng JL, Wang XF, Tian Y, Wang J, Li CP. Detection of T lymphocyte subsets and mIL-2R on surface of PBMC in patients with hepatitis B. World J Gastroenterol. 2003;9(9):2017-20.
• ²⁷
  Lohr HF, Gerken G, Schlicht HJ, Meryer zum Buschenfelde KH, Fleischer B. Low frequency of cytotoxic liver-infiltrating T lymphocytes specific for endogenous processed surface and core proteins in chronic hepatitis B. J Infect Dis. 1993;168(5):1133-9.
• ²⁸
  Huggins JT, Sahn SA. Causes and management of pleural fibrosis. Respirology. 2004;9(4):441-7.
• ²⁹
  Basturk B, Karasu Z, Kilic M, Ulukaya S, Boyacioglu S, Oral B. Association of TNF-alpha -308 polymorphism with the outcome of hepatitis B virus infection in Turkey. Infect Genet Evol. 2008;8(1):20-5.
• ³⁰
  Almeida NP, Santana GO, Almeida TC, Bendicho MT, Lemaire DC, Cardeal M, et al. Polymorphisms of the cytokine genes TGFB1 and IL10 in a mixed-race population with Crohn's disease. BMC Res Notes. 2013;6:387.
• ³¹
  Li H, Romieu I, Wu H, Sienra-Monge JJ, Ramirez-Aguilar M, del Rio-Navarro BE, et al. Genetic polymorphisms in transforming growth factor beta-1 (TGFB1) and childhood asthma and atopy. Hum Genet. 2007;121(5):529-38.
• ³²
  Schrijver HM, Crusius JB, Garcia-Gonzalez MA, Polman CH, Pena AS, Barkhof F, et al. Gender-related association between the TGFB1+869 polymorphism and multiple sclerosis. J Interferon Cytokine Res. 2004;24(9):536-42.
• ³³
  Sivangala R, Ponnana M, Thada S, Joshi L, Ansari S, Hussain H, et al. Association of cytokine gene polymorphisms in patients with tuberculosis and their household contacts. Scand J Immunol. 2014;79(3):197-205.
• ³⁴
  Ribeiro CS, Visentainer JE, Moliterno RA. Association of cytokine genetic polymorphism with hepatitis B infection evolution in adult patients. Mem Inst Oswaldo Cruz. 2007;102(4):435-40.
• ³⁵
  Mak JC, Leung HC, Sham AS, Mok TY, Poon YN, Ling SO, et al. Genetic polymorphisms and plasma levels of transforming growth factor-beta(1) in Chinese patients with tuberculosis in Hong Kong. Cytokine. 2007;40(3):177-82.
• ³⁶
  Pooja S, Francis A, Rajender S, Tamang R, Rajkumar R, Saini KS, et al. Strong impact of TGF-beta1 gene polymorphisms on breast cancer risk in Indian women: a case-control and population-based study. PLoS One. 2013;8(10):e75979.
• ³⁷
  Yu SK, Kwon OS, Jung HS, Bae KS, Kwon KA, Kim YK, et al. Influence of transforming growth factor-beta1 gene polymorphism at codon 10 on the development of cirrhosis in chronic hepatitis B virus carriers. J Korean Med Sci. 2010;25(10):564-9.
• ³⁸
  Frydecka D, Misiak B, Beszlej JA, Karabon L, Pawlak-Adamska E, Tomkiewicz A, et al. Genetic variants in transforming growth factor-beta gene (TGFB1) affect susceptibility to schizophrenia. Mol Biol Rep. 2013;40(10):5607-14.
• ³⁹
  Dunning AM, Ellis PD, McBride S, Kirschenlohr HL, Healey CS, Kemp PR, et al. A transforming growth factorbeta1 signal peptide variant increases secretion in vitro and is associated with increased incidence of invasive breast cancer. Cancer Res. 2003;63(10):2610-5.
• ⁴⁰
  Besnard AG, Sabat R, Dumoutier L, Renauld JC, Willart M, Lambrecht B, et al. Dual Role of IL-22 in allergic airway inflammation and its cross-talk with IL-17A. Am J Respir Crit Care Med. 2011;183(9):1153-63.
• ⁴¹
  Eskandari-Nasab E, Sepanjnia A, Moghadampour M, Hadadi-Fishani M, Rezaeifar A, Asadi-Saghandi A, et al. Circulating levels of interleukin (IL)-12 and IL-13 in Helicobacter pylori-infected patients, and their associations with bacterial CagA and VacA virulence factors. Scand J Infect Dis . 2013;45(5):342-9.
• ⁴²
  Eskandari-Nasab E, Moghadampour M, Asadi-Saghandi A, Kharazi-Nejad E, Rezaeifar A, Pourmasoumi H. Levels of interleukin-(IL)-12p40 are markedly increased in Brucellosis among patients with specific IL-12B genotypes. Scand J Immunol . 2013;78(1):85-91.
• ⁴³
  de la Fuente RA, Gutiérrez ML, Garcia-Samaniego J, Fernández-Rodriguez C, Lledó JL, Castellano G. Pathogenesis of occult chronic hepatitis B virus infection. World J Gastroenterol . 2011;17(12):1543-8.
• ⁴⁴
  Romani S, Azimzadeh P, Mohebbi SR, Kazemian S, Almasi S, Naghoosi H, et al. Investigation of Transforming Growth Factor-beta1 Gene Polymorphisms Among Iranian Patients With Chronic Hepatitis C. Hepat Mon . 2011;11(11):901-6.

• Financial Support: This study was funded by Zahedan University of Medical Sciences, Zahedan, Iran.

Publication Dates

• Publication in this collection
  May-Jun 2017

History

• Received
  30 June 2016
• Accepted
  06 Mar 2017