Effects of Evodia rutaecarpa Acupoint Sticking Therapy on Rats with Insomnia Induced by Para-Chlorophenylalanine in 5-HT_1Aand 5-HT_2A Gene Expressions

Abstract

The main feature of insomnia is difficulty in starting or maintaining sleep. 5-HT_1A receptor and 5-HT_2A receptor are two subtypes of the classic central 5-HT neurotransmitter closely related to sleep and wakefulness. To observe the effects of Evodia rutaecarpa acupoint sticking therapy on the mRNA expressions of 5-HT_1A and 5-HT_2A in the hypothalamus, brainstem, and hippocampus of insomnia rats induced by para-chlorophenylalanine (PCPA). Ten rats were randomly selected as the normal group, and 80 PCPA insomnia model rats were randomly divided into eight groups, including a model group, a positive control group (diazepam group), a low-dose E. rutaecarpa acupoint sticking therapy group (Yongquan acupoint group and Shenque acupoint group; the same applied below), a middle-dose E. rutaecarpa acupoint sticking therapy group, and a high-dose E. rutaecarpa acupoint sticking therapy group. The normal group and the model group did not receive treatment. The positive control group was given diazepam through intragastric administration, and the three-dose E. rutaecarpa acupoint sticking therapy groups were divided into the Yongquan acupoint group and the Shenque acupoint group. After seven days of administration, the rat hypothalamus, brainstem, and hippocampus tissues were taken, and a real-time polymerase chain reaction method was used to detect the mRNA expressions of 5-HT_1A and 5-HT_2A. E.rutaecarpa acupoint sticking therapy significantly upregulated 5-HT_1A mRNA expression and downregulated 5-HT_2A mRNA expression in rats with insomnia caused by PCPA. No significant differences were found in the expression between the two acupoints and the expression among the three brain tissues. E. rutaecarpa acupoint sticking therapy can improve insomnia. The mechanism may be related to the upregulation of 5-HT_1A mRNA expression and the downregulation of 5-HT_2A mRNA expression in brain tissue.

Keywords:
Evodia rutaecarpa; acupoint sticking; anti-insomnia; serotonin 1 A gene; serotonin 2A gene

HIGHLIGHTS

• E. rutaecarpa acupoint sticking therapy can improve insomnia.

• Significantly upregulated 5-HT_1A mRNA expression and downregulated 5-HT_2A mRNA expression.

HIGHLIGHTS

• E. rutaecarpa acupoint sticking therapy can improve insomnia.

• Significantly upregulated 5-HT_1A mRNA expression and downregulated 5-HT_2A mRNA expression.

INTRODUCTION

Insomnia is one of the diseases with a high incidence in today’s society, and it is also one of the clinical symptoms that often coexist with others. Good sleep can play an important role in the recovery of brain and body functions. The structures related to the control of arousal in the central nervous system are mainly located in the hypothalamus, brainstem, and hippocampus, among others [¹]. Serotonin (5-HT, 5-hydroxytryptamine) is important in the regulation of sleep and is one of the recognized mechanisms of insomnia.

However, the specific conditions of the neurotransmitter receptor subtypes and related signal transduction in the 5-HT sleep regulation mechanism are not completely clear, and relatively few studies have been conducted about them. The most notable of these receptors are 5HT_1A and 5HT_2A. Owing to their high density in the brain and important role in the nervous system, these receptors have been widely used to explain the pathogenesis of neurological diseases and the development of antidepressants and anti-anxiety drugs [²].

Studies have shown that 5-HT_1A receptors are distributed in high density in the hippocampus and that the activation of this receptor can relieve anxiety symptoms. Generally, low-dose 5-HT_1A receptor agonists can increase deep sleep and light sleep, and stimulated 5-HT_2A receptors can inhibit diffuse wave sleep and cause increased wakefulness [²-⁴].

The pathogenesis of insomnia is very complicated. Currently, the treatment for insomnia is still based on drug intervention. The most widely used drugs in clinical practice are benzodiazepine sedatives and hypnotics, which can effectively relieve insomnia symptoms and have sedative, hypnotic, and anti-anxiety effects. However, long-term use of these drugs can cause serious adverse reactions, such as central nervous system depression, drug resistance, withdrawal symptoms, addiction, and even chronic liver damage.

Traditional Chinese medicine has the good effects of nourishing the mind and soothing the nerves, with slight side effects and stable curative effects. Therefore, its use is recognized by the majority of insomnia patients [⁵-⁷]. Traditional Chinese medicine Evodia rutaecarpa is a commonly used acupoint drug in clinical practice. E. rutaecarpa can promote communication between the heart and kidneys and conduct a downward flow of heat. In clinical practice, vinegar is often used to prepare E.rutaecarpa powder and is applied to Yongquan acupoints, Shenque acupoints, and other acupoints to treat insomnia. It has achieved good results [⁸-⁹].

In this study, we observed the effects of vinegar blended with E.rutaecarpa powder on the Yongquan acupoints and Shenque acupoints in related neurotransmitters in insomnia rat models induced by PCPA and explored the mechanism of E.rutaecarpa in the treatment of insomnia to provide a basis for optimizing the clinical medication regimen for insomnia treatment.

MATERIAL AND METHODS

Experimental animals

Male Sprague-Dawley (SD) rats (weighing 200 ± 20 g) were purchased from the Experimental Animal Center of the Air Force Military Medical University (animal production license number: SCXK (Army) 2012-0007). The animals were fed a standard diet and water and maintained under the following conditions: room temperature 20 ℃-25 ℃, indoor lighting according to daylight cycle mode, feed timing, free drinking, and adaptive feeding for 15 days.

Instruments and reagents

P-Chlorophenyl alanine (PCPA) was purchased from Alfa Aesar (USA; batch number: H30Y014), Trizol from Invitrogen, and DEPC-treated water from Wuxi Bohe Biomedical Technology Co., Ltd. Chloroform/isopropanol/absolute ethanol was obtained from Shanghai Sinopharm (Shanghai, China). The SYBR Green polymerase chain reaction (PCR) kit (Thermo F-415XL) and the Reverse Transcription Kit (Thermo #K1622) were obtained from Thermo. Diazepam tablets (National Medicine Standard H37023039) were purchased from Shandong Xinyi Pharmaceutical Co., Ltd. (Shandong, China). E. rutaecarpa was obtained from Anhui Hui Rentang Traditional Chinese Medicine Decoction Pieces Co., Ltd. (Anhui, China). Vinegar was purchased from Shaanxi Qishan Tianyuan Food Co., Ltd. (Tianyuan, China). Sterile water for injection was purchased from Huaren Pharmaceutical Co., Ltd. (Shandong, China, Batch number 161221R1). Saline was obtained from Huaren Pharmaceutical Co., Ltd. (Shandong, China, Batch number 161221R1).

Drug preparation

E. rutaecarpa powder was pulverized into a fine powder (80 mesh), added with rice vinegar, stirred into a paste (approximately 1.5 g : 1 mL), placed in a sealed glass bottle, and stored in a refrigerator at 4°C for application.

Modeling and grouping

After seven days of adaptive feeding, male SD insomnia rats were induced by the PCPA method [²,¹⁰-¹¹]. PCPA powder was prepared into a suspension with weak alkaline saline (pH 7-8) and injected intraperitoneally at a dose of 0.3 g/kg (1 mL/100 g dose) once a day at 8 a.m. for four consecutive days. The rats in the normal group were injected with the same volume of weak alkaline saline. The circadian rhythm disappeared in the rats, indicating that the model was successfully replicated. However, the rats without PCPA were normal.

A total of 80 successfully modeled rats were randomly divided into a model group, a positive control group (diazepam group), a small-dose E.rutaecarpa acupoint sticking therapy group (Y-L for Yongquan acupoint and S-L for Shenque acupoint), a medium-dose E. rutaecarpa acupoint sticking therapy group (Y-M for Yongquan acupoint and S-M for Shenque acupoint), and a high-dose E.rutaecarpa acupoint sticking therapy group (Y-H for Yongquan acupoint and S-H for Shenque acupoint). Each group included 10 rats. The normal control group consisted of 10 rats without PCPA treatment.

Real-time PCR

Real-time PCR was used to detect 5-HT_1A and 5-HT_2A mRNA expressions in the rat hypothalamus, brainstem, and hippocampus. 5-HT_1A and 5-HT_2A gene primers and GAPDH internal reference gene primers were described in Table 1. The reaction system was carried out according to the product manual. The amplification conditions were 94℃ for 10 min (94℃ for 20 s, 55℃ for 20 s, 72℃ for 20 s) for 40 cycles. After PCR amplification, real-time fluorescent quantitative PCR automatically analyzed the cycle threshold (Ct) value. The 2^-∆∆Ct method was used to analyze the expression difference of the target gene between the control group and the different concentration groups. The calculation formula is as follows: △Ct = Ct target gene-Ct internal reference. The average value of the control group △Ct is expressed as △Ct control average. The △Ct control average is subtracted from the △Ct of each group to obtain the △△Ct value: △△Ct = △Ct sample-△Ct control average. Then, the 2^-∆∆Ct value of each group, which is the relative expression of genes in each group, was calculated.

Table 1
5-HT_1A, 5-HT_2A and GAPDH primer list.

Primer	Upstream	Downstream	Annealing temperature	Amplification length
5-HT1A 5-HT2A GAPDH	CGGCTACACCATCTACTCCACTTTC CTTCCAACGGTCCATCCACAGA CCATCACTGCCACTCAGAAGA	CTGGCTGTCCGTTCAGGCTCTTC GGGCACCACATTACAACAAACAGG ATACATTGGGGGTAGGAACAC	55℃ 55℃ 55℃	72℃ 72℃ 72℃

Statistical methods

Statistical analysis was performed using SPSS 17.0. The experimental data were expressed as the mean ± standard deviation. The comparison of measurement data between groups was performed using one-way analysis of variance. P < 0.05 indicates a difference and statistical significance; P < 0.01 indicates a significant difference.

RESULTS

Effect of E. rutaecarpa acupoint sticking therapy on 5-HT _1A mRNA expression in the hypothalamus, brainstem, and hippocampus of insomnia rats

Relative expression of 5-HT _1A mRNA in the hypothalamus

Unlike in the normal group, the 5-HT_1A mRNA expressions of rats in the model group, Y-L group, S-L group, Y-M group and S-M group decreased significantly (P < 0.01). The 5-HT_1A mRNA expression of rats in the S-H group decreased (P < 0.05).

Unlike in the model group, the 5-HT_1A mRNA expressions of rats in the diazepam group, Y-H group and S-H group increased significantly (P < 0.01). The 5-HT_1A mRNA expression of rats in the Y-M group and S-M group increased (P < 0.05).

Compared with the diazepam group, the Y-L group and S-L group had no significant effect on the increase in 5-HT_1A mRNA expression in rats (P < 0.01). The Y-M group and S-M group increased the expression of 5-HT_1A mRNA in rats (P < 0.05), the Y-H group and S-H group had no significant increase in the expression of 5-HT_1A mRNA in rats. No significant difference was found in the expression between the two acupoints.

Relative expression of brainstem 5-HT_1A mRNA

Unlike in the normal group, the 5-HT_1A mRNA expressions of rats in the model group, Y-L group, S-L group, Y-M group, and S-M group decreased significantly (P < 0.01). The 5-HT_1A mRNA expression of rats in the Y-H group and S-H group decreased (P < 0.05).

Unlike in the model group, the 5-HT_1A mRNA expressions of rats in the diazepam group, Y-M group, S-M group, Y-H group, and S-H group significantly increased (P < 0.01). The 5-HT_1A mRNA expression of rats in the S-L group increased (P < 0.05).

Compared with the diazepam group, Y-L group, S-L group and S-M group had no significant effect on the increase in 5-HT_1A mRNA expression in rats (P < 0.01). The Y-M group increased the expression of 5-HT_1A mRNA in rats (P < 0.05), and the Y-H group and S-H group had no significant effect on rats. No significant difference was found in the increasing effect of 5-HT_1A mRNA expression in rats. Moreover, no significant difference was observed in the expression between the two acupoints.

Relative expression of hippocampal 5-HT_1A mRNA

Unlike in the normal group, the 5-HT_1A mRNA expressions of rats in the model group, Y-L group, S-L group, Y-M group, and S-M group significantly decreased (P < 0.01). The 5-HT_1A mRNA expression of rats in the Y-H group and S-H group also significantly decreased (P < 0.05).

Unlike in the model group, the 5-HT_1A mRNA expressions of rats in the diazepam group, Y-M group, S-M group, Y-H group, and S-H group significantly increased (P < 0.01).

Compared with the diazepam group, the Y-L group, S-L group, Y-M group, and S-M group had no significant increase in 5-HT_1A mRNA expression in the rats (P < 0.01). No significant difference was found in the increase in 5-HT_1A mRNA expression in rats in the Y-H group and S-H group. No significant difference was observed in the expression between the two acupoints.

The above results suggest that E.rutaecarpa acupoint application can increase 5-HT_1A mRNA expression in the hypothalamus, brainstem, and hippocampus of insomnia rats and that there is no significant difference between the high-dose group and the diazepam group. This indicates that the E.rutaecarpa acupoint application can play a role in the treatment of insomnia. The relative expression of 5-HT_1A mRNA and the comparison among the groups are shown in Table 2.

Table 2
Relative expression of 5-HT1A mRNA in hypothalamus, brainstem and hippocampus（mean ± SEM, n=10).

Group	Hypothalamus 5-HT1A mRNA Hypothalamus	Brainstem 5-HT1A mRNA Brainstem	Hippocampal 5-HT1A mRNA Hippocampus
Normal	1.00305±0.00895	1.00276±0.00806	1.00042±0.00125
Model	0.24361±0.01495**	0.30147±0.00125**	0.20615±0.00129**
Diazepam	0.85956±0.01338##	0.85193±0.00327##	0.93938±0.00578##
WZYL-YQ	0.39538±0.00449**&&	0.36389±0.01335**&&	0.26593±0.00758**&&
WZYL-SQ	0.34277±0.01651**&&	0.41027±0.00265**#&&	0.30385±0.00550**&&
WZYM-YQ	0.49440±0.00657**#&	0.62073±0.00437**##&	0.45215±0.00212**##&&
WZYM-SQ	0.54645±0.00093**#&	0.56502±0.00830**##&&	0.51989±0.00337**##&&
WZYH-YQ	0.78779±0.01175##	0.75372±0.01021*##	0.81191±0.00382*##
WZYH-SQ	0.71350±0.00658*##	0.76542±0.00515*##	0.75196±0.01049*##

• Note: Compared with the normal group, *P<0.05, **P<0.01; compared with the model group, # P<0.05, ## P<0.01; compared with the diazepam group, &P<0.05, &&P<0.01.

Effect of E.rutaecarpa acupoint sticking therapy on 5-HT _2A mRNA expression in the hypothalamus, brainstem, and hippocampus of insomnia rats

Relative expression of 5-HT _2A mRNA in the hypothalamus

Compared with the normal group, the model group, Y-L group, S-L group, Y-M group, S-M group, and S-H group had a significantly increased expression of 5-HT_2A mRNA in rats (P < 0.01). The expression of 5-HT_2A mRNA in rats in the Y-H group increased (P < 0.05).

Unlike in the model group, the 5-HT_2A mRNA expression in rats in the diazepam group, the Y-M group, S-M group, Y-H group, and S-H group significantly decreased (P < 0.01). The expression of 5-HT_2A mRNA in rats in the Y-L group and S-L group decreased (P < 0.05).

Compared with the diazepam group, the Y-L group, S-L group and Y-M group had no significant effect on reducing 5-HT_2A mRNA expression in rats (P < 0.01). The S-M group had a decreased expression of 5-HT_2A mRNA in rats (P < 0.05), and the Y-H group, S-H group had no significant decrease in HT_2A mRNA expression. No significant difference was found in the expression between the two acupoints.

Relative expression of 5-HT_2A mRNA in the brainstem

Compared with the normal group, the model group, the Y-L group, S-L group, Y-M group, S-M group, Y-H group, and S-H group had a significantly increased expression of 5-HT_2A mRNA in rats (P < 0.01). Unlike in the normal group, the expression of 5-HT_2A mRNA in rats in the diazepam group increased (P < 0.05).

Compared with the model group, the diazepam group, the Y-M group, S-M group, Y-H group, and S-H group had a significantly decreased 5-HT_2A mRNA expression in rats (P < 0.01).

Compared with the diazepam group, the Y-L group, S-L group, and Y-M group had no significant effect on decreasing the 5-HT_2A mRNA expression in rats (P < 0.01). The S-M group had a decreased expression of 5-HT_2A mRNA in rats (P < 0.05), and the Y-H group and S-H group had no significant decrease in HT_2A mRNA expression in rats. No significant difference was found in the expression between the two acupoints.

Relative expression of 5-HT_2A mRNA in the hippocampal

Compared with the normal group, the model group, the Y-L group, S-L group, Y-M group, S-M group, Y-H group, and S-H group had a significantly increased expression of 5-HT_2A mRNA in rats (P < 0.01).

Compared with the model group, the diazepam group, the Y-L group, S-L group, Y-M group, S-M group, Y-H group, and S-H group had a significantly decreased expression of 5-HT_2A mRNA in rats (P < 0.01).

Compared with the diazepam group, the Y-L group, S-L group, Y-M group, and S-M group had no significant effect on the decrease in 5-HT_2A mRNA expression in rats (P < 0.01). The Y-H group and S-H group had a decreased expression of 5-HT_2A mRNA in rats (P < 0.05). No significant difference was found in the expression between the two acupoints.

The above results suggest that the acupoint application of E. rutaecarpa can decrease the 5-HT_2A mRNA expression in the hypothalamus, brainstem, and hippocampus of insomnia rats. Moreover, no significant difference was found between the high-dose group (hypothalamus and brainstem) and the diazepam group, indicating that E. rutaecarpa acupoint application can play a role in treating insomnia. The relative expression of 5-HT_2A mRNA and the comparison among the groups are shown in Table 3.

Table 3
Relative expression of 5-HT_2A mRNA in hypothalamus, brainstem and hippocampus (mean ± SEM, n=10).

Group	Hypothalamus 5-HT2A mRNA Hypothalamus	Brainstem 5-HT2A mRNA Brainstem	Hippocampus 5-HT2A mRNA Hippocampus
Normal	1.00472±0.01356	1.00423±0.01296	1.00293±0.00856
Model	2.20533±0.01014**	2.19565±0.01343**	2.40645±0.00284**
Diazepam	1.19862±0.01457##	1.34710±0.01164*##	1.16622±0.00530##
WZYL-YQ	1.90702±0.01005**#&&	2.09627±0.01048**&&	1.93847±0.01220**##&&
WZYL-SQ	1.85992±0.01386**#&&	2.03950±0.01365**&&	2.07668±0.00836**##&&
WZYM-YQ	1.64800±0.00408**##&&	1.69374±0.00124**##&&	1.76388±0.01344**##&&
WZYM-SQ	1.58521±0.00692**##&	1.69147±0.00934**##&	1.71799±0.00444**##&&
WZYH-YQ	1.29353±0.00453*##	1.47376±0.01246**##	1.45224±0.00719**##&
WZYH-SQ	1.39649±0.00719**##	1.53446±0.00513**##	1.37147±0.00961**##&

• Note: Compared with the normal group, *P<0.05, **P<0.01; compared with the model group, #P<0.05, ## P<0.01; compared with the diazepam group, &P<0.05, &&P<0.01.

DISCUSSION

As we all know, good sleep is an important sign of health. In Chinese medicine, E.rutaecarpa acupoint application is often used to treat insomnia. The commonly used acupoints in clinical practice are mainly Yongquan acupoint and Shenque acupoint [⁸-⁹] [¹²-¹⁵]. Previous research has shown that the main chemical components of E.rutaecarpa are alkaloids, bitters, volatile oils, flavonoids, and organic acids [¹⁶-¹⁷]. Several studies have found that evodiaeine and rutaecarpine can exert antidepressant effects by increasing the expression of neurotransmitters in the rat brain and inhibiting the apoptosis of hippocampal nerve cells in mice [¹⁸-¹⁹]

Rutaecarpine, evodiaeine, limonin, rutin, and dehydro-evodia oleifera are the main analgesic components of evodia [²⁰-²¹]. The rutaecarpine exerts sedative and anti-anxiety depression effects by regulating the activity of neurotransmitter receptors [ ²²]. Evodia can reduce the excitement caused by coffee and improve sleep disorders [²³]. Flavonoids such as quercetin and rutin are active substances that improve PCPA caused insomnia [²⁴-²⁵].

This study used isolated rat skin as a permeation barrier, and through in vitro transdermal absorption experiments, the mass concentration of relevant components in the receiving fluid and the skin is detected by high-performance liquid chromatography. We found that evodiaeine can penetrate through the isolated skin, and the rutaecarpine is retained in the skin. The retention amount of rutaecarpine is more than that of evodiaeine, and the limonin cannot penetrate the isolated skin. According to the results of the isolated skin permeation experiment, the rutaecarpine has a good in vitro transdermal release performance, which provides a piece of evidence for further study of the mechanism of Evodia in the treatment of insomnia [²⁶].

In this study, each rat only sticks to one acupoint, in order to observe and analyze the therapeutic effect and mechanism of the Evodia on different acupoints. Taking into account the limitation of the body surface area of rats, in actual operation, it is impossible to apply the drug to only a certain acupoint, but to apply the drug to a skin area centered on the acupoint. This approach is also the same as that of people using acupoint applications in clinics.

The serotonin synthesis inhibitor p-chlorophenylalanine (PCPA) can cause insomnia by antagonizing the serotonin precursor 5HTP. In this study, the expression of 5-HT_1A and 5-HT_2A genes in the hypothalamus, brainstem, and hippocampus of the model group of rats showed a significant decrease or increase. After intraperitoneal injection of PCPA, rats have successively shortened their sleep time, easily awakened, irritable, the struggling amplitude becomes smaller or no longer struggling during grasping, and the amount of eating and activity is markedly reduced, indicating that the insomnia model was successfully generated. That is to say, combining the neurotransmitter expression level with the external physical signs of rats can be more accurately judged whether the PCPA insomnia model has been successfully prepared.

5-HT in the brain has a wide range of functions, mainly involved in the regulation of sleep-wake cycles, pain, and mental and emotional activities. Due to their high density and important role in brain tissue, 5HT_1A and 5HT_2A receptors are widely used in the research of anti-insomnia drugs. E.rutaecarpa acupoint application can increase the expression level of 5-HT_1A mRNA in rat brain tissue, and the expression level is positively correlated with the dosage of application. E.rutaecarpa acupoint application can reduce the expression level of 5-HT_2A mRNA in rat brain tissue, and the expression level is negatively correlated with the dosage of application. This is consistent with the current research results of the two receptor subtypes 5-HT_1A and 5-HT_2A in the treatment of insomnia.

Based on the 5-HT_1A mRNA and 5-HT_2A mRNA expression levels in the brain in this study, there is no significant difference between the two acupoints and in the three brain tissues in the expression level. This suggests that up-regulation of the expression levels of 5-HT_1A mRNA in the brain, and down-regulation of the expression level of 5-HT_2A mRNA in the brain (mainly the hypothalamus and brainstem) is also one of the mechanisms of E.rutaecarpa acupoint application in the treatment of insomnia, fully demonstrating the scientific nature of the clinical use of acupoint applications to treat insomnia using Chinese medicine.

The research results also indicate that the anti-insomnia effect of the high-dose Evodia acupoint application group is similar to that of the diazepam group, which verifies the good clinical value and scientific value of the traditional treatment technology of Evodia acupoint application for insomnia from an experimental point of view. This research will open up a new research direction for finding ideal anti-insomnia drugs that are convenient to use, have few adverse reactions, and have better curative effects.

CONCLUSION

E.rutaecarpa acupoint application had a good therapeutic effect on insomnia induced by PCPA in rat models. The effect was equivalent to diazepam, and there was no significant difference. According to the results of this study, its mechanism of action may be related to the up-regulation of 5-HT_1A mRNA expression levels in the hypothalamus, brainstem, and hippocampus and the down-regulation of 5-HT_2A mRNA expression levels in the hypothalamus and brainstem, showing good clinical application value and scientific research potential.

REFERENCES

• ¹
  Xu F. The mechanism research on the curative effect of “Shu-Mian decoction” for insomnia based on the 5HT1A、5HT2A、DD2 receptor system and HPA axis [dissertation]. Changchun Uni.Chin Med; 2014.27 p.
• ²
  Luo BH, Wang Y, Zhang YF, Chen ZJ, Guo YW, Zhao L. Study of three acupunture methods affecting total RNA expressions of 5-HT1A and 5-HT2A in hippocampus of PCPA insomnia rats. Chin. Arch. Tradit. Chin. Med. 2017;10:2630-3.
• ³
  Mao DD. Research on the effect and mechanism of Qiao meridian acupuncture on characteristic of locomotor activity circadian rhythm and expression of 5-HT1AR、5-HT2AR mRNA and protein in hippocampus in sleep deprivation rats [master's thesis]. Chengdu Uni.Chin. Med; 2016.51 p.
• ⁴
  Wang Q, Li Y, Li Y, Wu X. Exploration of therapeutic effects and mechanisms of Huatan Quyu decoction on insomnia rats. World J. Tradit. Chin. Med. 2020;14: 2063-7.
• ⁵
  Liang Y, Wang WD, Zhang HY, Wang XC, Gu WL, Zhao SK, Wei M. A randomized study comparing the efficacy and safety of Shumian capsules and Jieyuanshen capsules in the treatment of insomnia. Chin. J. New Drugs.2015;10:1155-9.
• ⁶
  Zhang FY, Li JJ,Zhou Y,Xu XY. Review for sedative and hypnotic mechanism of sedative traditional Chinese medicine and relative active components on neurotransmitters. China J. Chin. Mater. Med.2016;23: 4320-7.
• ⁷
  Xiang XJ,Liu TB,Wang CY,Liu TQ,Zhou YF,Ruan CJ. Adverse reactions and management of benzodiazepines. Chin. J. Drug Abuse Prev. Treat.2017;5:256-60.
• ⁸
  Ju Y and Yue Y. The clinical progress of wuzhuyu point application by drug-point matching method. Guangming J. Chin. Med.2015;11: 2490-2.
• ⁹
  Shen Q,Wang B,Jin CL. Research progress on treatment of insomnia by acupoint application of Yongquan acupoint of Fructus Euodiae. Global Tradit. Chin. Med.2013; 6:48-9.
• ¹⁰
  Yue H, Zhou XY, Li CY, Zou ZJ, Wang SM, Liang SW, et al. Intervention effects of Jiaotai pills on PCPA-induced insomnia in rats. China J. Chin. Mater. Med. 2016;18: 3451-6.
• ¹¹
  Wang H, Zang YZ, Wu J, Chen TQ. Effect of suanzaoren decoction on cAMP and PKA after metabolic glutamate receptor and receptor in the cerebral cortex of pcpa insomnia rats.J. Basic Chin. Med.2018; 1:34-7.
• ¹²
  Zhu LL. Clinical effect of cinnamon powder application on Yongquan point combined with auricular point in the treatment of senile insomnia. Chin. Community Doc.2020;34: 111-2.
• ¹³
  Xiang YM, Chen MH, Wei YM. Clinical study on point application with Fructus Evodiae at Yongquan point for patients with insomnia during orthopedic perioperative period. J.New Chin.Med.2020;9:185-7.
• ¹⁴
  Wang XR. Observation on the curative effect of treating insomnia by applying yongquan point in vinegar mixed with Fructus Evodiae. Pract. Clin. J.Integrate. Tradit. Chin. West. Med.2020; 2:50-2.
• ¹⁵
  Liu L. Observation on the effect of Shenque acupoint applied with traditional Chinese medicine in insomnia patients with yin deficiency and fire intensity. Electr. J.Pract. Clin. Nurs. Sci.2020; 9:60.
• ¹⁶
  Wei ST, Liu YQ, Huang J, Sheng YH, Tang LM. Research progress of chemical component，medicinal efficacy and liver toxicity of Fructus Evodiae. World J. Tradit. Chin. Med. 2020;23: 3580-5.
• ¹⁷
  Liu SS, Zhou XQ, Liang CX, Zhang QW, Yan LH, Wang ZM. Chemical constituents from aqueous extract of Euodiae Fructus. Chin. J. Exp. Tradit. Med. Formulae.2016;8:58-64.
• ¹⁸
  Han ZF, Liu SM, Liu XQ, Dong X. The effect of Evodia on the protection of AD mice and the regulation of learning and memory ability. Res. Pract. Chin. Med.2018;6: 28-30.
• ¹⁹
  Yuan ZJ, Wu XY, He WJ. Anti-depressant effects of rutaecarpine on chronic unpredictable mild stimulation in rats and its mechanism. Drugs Clin.2019;11:3197-202.
• ²⁰
  Chen Y, Wei GB, Liang J, Dong W, Dong JH, LI F, Yang WL, Chen HF, Yuan JB. Spectrum-effect relationship of analgesic effect of Euodia Fructus based on OPLS analysis. China J. Tradit. Chin. Med. Pharm.2019;2: 781-6.
• ²¹
  Yin LS, Sun R, Huang W, Li XY. Study on analgestic effect and safety scope of different components of Evodia Fructus on mice of stomach cold-syndrome. Pharmacol.Clin. Chin. Mater. Med.2016;2: 124-7.
• ²²
  Li L, Lu JJ, Wang WT, Wang N, Wang LX, Ma YM, et al. Potential targets of Euodiae Fructus in treatment of insomnia based on network pharmacology. China J. Chin. Mater. Med.2021;12: 3016-23.
• ²³
  Ko YH, Shim KY, Lee SY, Jang CG. Evodiamine reduces caffeine-induced sleep disturbances and excitation in mice. Biomol.Ther.2018;5:432-8.
• ²⁴
  Liu J, Guo X, Huang NN, Wu KY, Sun R. Study on efficacy network of Chaihu Guizhi Ganjiang Decoction in treating insomnia.Chin.Tradit.Herb. Drugs. 2019;21: 5145-53.
• ²⁵
  Xiao FQ. Study on the improvement of sleep active sites in Suanzaoren[master's thesis]. Changchun:Changchun University of Chinese medicine;2020.4 p.
• ²⁶
  Zhao Q, Zhang RT, Zhang JW, Wang QW, Qiao YG, Zhao CB, et al. In vitro percutaneous absorption of Fructus Evodiae powder and its main active ingredients. Acta Chin. Med.2019;8: 1730-4.

• Funding:

  This study was supported by 2019 Xianyang City Science and Technology Research and Development Key Plan Project (Project Number: 2019k02-109); Key R&D Program of Shaanxi Provincial Department of Science and Technology in 2017 (Project Number: 2017SF-366).

Edited by

Editor-in-Chief:

Alexandre Rasi Aoki

Associate Editor:

Alexandre Rasi Aoki

Publication Dates

• Publication in this collection
  27 May 2022
• Date of issue
  2022

History

• Received
  29 Apr 2021
• Accepted
  11 Feb 2022