Frequency of the allelic variant (Trp8Arg/Ile15Thr) of the luteinizing hormone gene in a Brazilian cohort of healthy subjects and in patients with hypogonadotropic hypogonadism

Freqüência da variante alélica (Trp8Arg/Ile15Thr) do gene do hormônio luteinizante em um grupo de brasileiros saudáveis e pacientes portadores de hipogonadismo hipogonadotrófico

Abstracts

PURPOSE: To evaluate the frequency of allelic variant Trp8Arg/Ile15Thr in the luteinizing hormone beta-subunit gene in a Brazilian population of healthy subjects and in patients with hypogonadotropic hypogonadism. SUBJECTS AND METHODS: Two hundred and two adults (115 women) with normal sexual function and 48 patients (24 women) with hypogonadotropic hypogonadism underwent a molecular study of the the luteinizing hormone beta-subunit gene using a polymerase chain reaction technique followed by enzymatic digestion with the restriction enzymes Nco I (for detection of the Trp8Arg point mutation) and Fok I (for detection of the Ile15Thr point mutation). Basal luteinizing hormone and FSH, testosterone, or estradiol levels were measured in 37 healthy subjects (21 women) and in 27 hypogonadotropic hypogonadism patients (13 women) by immunofluorometric methods (hLH-Spec and hFSH-Spec, AutoDELFIA, Wallac Oy, Turku, Finland). RESULTS: The genetic variant of the luteinizing hormone beta-subunit gene was present at a similar frequency in healthy subjects (14.4%) compared to patients with hypogonadotropic hypogonadism (16.6%). There was no effect of the allelic variant of the luteinizing hormone beta-subunit gene on luteinizing hormone levels in patients with hypogonadotropic hypogonadism as compared to healthy subjects. CONCLUSION: This study indicates that the allelic variant Trp8Arg/Ile15Thr of the luteinizing hormone beta-subunit gene is a common polymorphism in the Brazilian population (14.4%). The same frequency of this luteinizing hormone variant in the groups with hypogonadotropic hypogonadism and in the healthy subjects excludes a relationship between this variant and hypogonadotropic hypogonadism.

Luteinizing hormone; Allelic variants of the LH beta-subunit gene; Polymerase chain reaction; Brazilian population; Hypogonadotropic hypogonadism

OBJETIVO: Avaliar a freqüência da variante alélica (Trp8Arg/Ile15Thr) do gene da subunidade beta do hormônio luteinizante em um grupo de brasileiros saudáveis e em pacientes portadores de hipogonadismo hipogonadotrófico. CASUÍSTICA E MÉTODOS: Duzentos e dois adultos (115 mulheres) com função sexual preservada e 48 pacientes (24 mulheres) portadoras de hipogonadismo hipogonadotrófico foram submetidos a estudo molecular utilizando técnicas de reação em cadeia da polimerase seguida por digestão enzimática com as enzimas de restrição Nco I (para detecção da mutação pontual Trp8Arg) e Fok I (para detecção da mutação pontual Ile15Thr). Os níveis basais de hormônio luteinizante e FSH, testosterona ou estradiol foram dosados em 37 indivíduos normais (21 mulheres) e 27 pacientes portadores de hipogonadismo hipogonadotrófico (13 mulheres) pelo método imunofluorométrico (hLH-Spec and hFSH-Spec, AutoDELFIA, Wallac Oy, Turku, Finland). RESULTADOS: A variante alélica (Arg8/Thr15) do gene da subunidade beta do LH apresentou freqüência similar nos indivíduos saudáveis (14.4%) e nos pacientes portadores de hipogonadismo hipogonadotrófico (16.6%). Não houve interferência da variante alélica do gene da subunidade beta do LH nos níveis de LH dos indivíduos normais e dos pacientes portadores de hipogonadismo hipogonadotrófico. CONCLUSÃO: Este estudo indica que a variante alélicaArg8/Thr15 do gene da subunidade beta do LH é um polimorfismo comum na população brasileira (14.4%). A freqüência similar dessa variante em indivíduos saudáveis e em portadores de hipogonadismo hipogonadotrófico exclui o papel da variante na etiologia do hipogonadismo hipogonadotrófico.

Hormônio luteinizante; Variantes alélicas do gene da subunidade beta do LH; Reação em cadeia de polimerase; População brasileira; Hipogonadismo hipogonadotrófico

ORIGINAL RESEARCH

Frequency of the allelic variant (Trp8Arg/Ile15Thr) of the luteinizing hormone gene in a Brazilian cohort of healthy subjects and in patients with hypogonadotropic hypogonadism

Freqüência da variante alélica (Trp8Arg/Ile15Thr) do gene do hormônio luteinizante em um grupo de brasileiros saudáveis e pacientes portadores de hipogonadismo hipogonadotrófico

Karina Berger; Ana Elisa Correia Billerbeck; Elaine Maria Frade Costa; Luciani Silveira Carvalho; Ivo Jorge Prado Arnhold; Berenice Bilharinho Mendonca

Endocrinology Unit, Hospital das Clínicas, São Paulo University Medical School - São Paulo/SP, Brazil. Hormone and Molecular Genetics Laboratory, Hospital das Clínicas, São Paulo University Medical School - São Paulo/SP, Brazil. Email:[e-mail]

ABSTRACT

PURPOSE: To evaluate the frequency of allelic variant Trp8Arg/Ile15Thr in the luteinizing hormone b-subunit gene in a Brazilian population of healthy subjects and in patients with hypogonadotropic hypogonadism.

SUBJECTS AND METHODS: Two hundred and two adults (115 women) with normal sexual function and 48 patients (24 women) with hypogonadotropic hypogonadism underwent a molecular study of the the luteinizing hormone b-subunit gene using a polymerase chain reaction technique followed by enzymatic digestion with the restriction enzymes Nco I (for detection of the Trp8Arg point mutation) and Fok I (for detection of the Ile15Thr point mutation). Basal luteinizing hormone and FSH, testosterone, or estradiol levels were measured in 37 healthy subjects (21 women) and in 27 hypogonadotropic hypogonadism patients (13 women) by immunofluorometric methods (hLH-Spec and hFSH-Spec, AutoDELFIA, Wallac Oy, Turku, Finland).

RESULTS: The genetic variant of the luteinizing hormone b-subunit gene was present at a similar frequency in healthy subjects (14.4%) compared to patients with hypogonadotropic hypogonadism (16.6%). There was no effect of the allelic variant of the luteinizing hormone b-subunit gene on luteinizing hormone levels in patients with hypogonadotropic hypogonadism as compared to healthy subjects.

CONCLUSION: This study indicates that the allelic variant Trp8Arg/Ile15Thr of the luteinizing hormone b-subunit gene is a common polymorphism in the Brazilian population (14.4%). The same frequency of this luteinizing hormone variant in the groups with hypogonadotropic hypogonadism and in the healthy subjects excludes a relationship between this variant and hypogonadotropic hypogonadism.

Key words: Luteinizing hormone. Allelic variants of the LH b-subunit gene. Polymerase chain reaction. Brazilian population. Hypogonadotropic hypogonadism.

RESUMO

OBJETIVO: Avaliar a freqüência da variante alélica (Trp8Arg/Ile15Thr) do gene da subunidade b do hormônio luteinizante em um grupo de brasileiros saudáveis e em pacientes portadores de hipogonadismo hipogonadotrófico.

CASUÍSTICA E MÉTODOS: Duzentos e dois adultos (115 mulheres) com função sexual preservada e 48 pacientes (24 mulheres) portadoras de hipogonadismo hipogonadotrófico foram submetidos a estudo molecular utilizando técnicas de reação em cadeia da polimerase seguida por digestão enzimática com as enzimas de restrição Nco I (para detecção da mutação pontual Trp8Arg) e Fok I (para detecção da mutação pontual Ile15Thr). Os níveis basais de hormônio luteinizante e FSH, testosterona ou estradiol foram dosados em 37 indivíduos normais (21 mulheres) e 27 pacientes portadores de hipogonadismo hipogonadotrófico (13 mulheres) pelo método imunofluorométrico (hLH-Spec and hFSH-Spec, AutoDELFIA, Wallac Oy, Turku, Finland).

RESULTADOS: A variante alélica (Arg8/Thr15) do gene da subunidade b do LH apresentou freqüência similar nos indivíduos saudáveis (14.4%) e nos pacientes portadores de hipogonadismo hipogonadotrófico (16.6%). Não houve interferência da variante alélica do gene da subunidade b do LH nos níveis de LH dos indivíduos normais e dos pacientes portadores de hipogonadismo hipogonadotrófico.

CONCLUSÃO: Este estudo indica que a variante alélicaArg8/Thr15 do gene da subunidade b do LH é um polimorfismo comum na população brasileira (14.4%). A freqüência similar dessa variante em indivíduos saudáveis e em portadores de hipogonadismo hipogonadotrófico exclui o papel da variante na etiologia do hipogonadismo hipogonadotrófico.

Unitermos: Hormônio luteinizante. Variantes alélicas do gene da subunidade b do LH. Reação em cadeia de polimerase. População brasileira. Hipogonadismo hipogonadotrófico.

Luteinizing hormone (LH), as are other members of the glycoprotein family, is a heterodimer that consists of a common a-subunit and a unique b-subunit that confers biological specificity for the hormone receptor in the target organ.¹ It is produced and secreted in the anterior pituitary, and it is essential in the stimulation of follicle growth and maturation of the oocyte. It has a central role in promoting spermatogenesis and ovulation by stimulating the testes and ovaries, respectively, to synthesize steroids.^1-3 An intact b-subunit is required for its biological activity. However, microheterogeneity and genetic variants of LH are known to exist.^4-6 The gene that encodes the human LH b-subunit has been cloned and sequenced;⁷ it is located on chromosome 19.⁸ Some point mutations that cause hypogonadotropic hypogonadism^9-10 and infertility in both sexes have been identified in the LH b-subunit gene.^11-14

Two successive point mutations in exon 2 of the LH b-subunit gene cause an immunologically anomalous LH by replacing 2 amino acids in the hormone molecule: Trp8 (TGG) by Arg8 (CGG) and Ile15 (ATC) by Thr15 (ACC).⁶ The latter amino acid substitution introduces an extra glycosylation signal into the LH beta chain (Asn13-Ala14-Thr15). This molecular change results in nonmeasurable LH levels when immunoassays using antibodies against the intact LH molecule are used.^6,15-17 These polymorphisms are in complete linkage disequilibrium, and they have been found in both infertile patients and reproductively healthy subjects of several populations, with a relatively high frequency (41.9% to 53.5%) in Finnish Lapp populations and in Australian aborigines.^13-14,18-27 Latin-American populations have not been studied to date.

Our aim was to establish the frequency of the allelic variant Trp8Arg/Ile15Thr in the LH b-subunit gene in a Brazilian population of healthy subjects and in patients with hypogonadotropic hypogonadism (HH).

SUBJECTS AND METHODS

Subjects

This study was approved by the Institutional Review Board of the Hospital das Clinicas, School of Medicine, São Paulo University, Sao Paulo, Brazil.

The study sample consisted of 202 Brazilian adults (115 women) with normal sexual function and 48 patients (24 women) with HH without steroid intake.

DNA Analysis

Genomic DNA was extracted from peripheral blood lymphocytes by standard techniques. DNA amplification of the LH b-subunit gene was carried out using the polymerase chain reaction (PCR) with specific primers: LH forward (ACCTGAACCACACCCACTTC) and LH reverse (GTATGTGTGGTTGCCCTGAG). The PCR procedure was carried out in a total volume of 50 µ L reaction mixture, containing 100 to 500 ng of genomic DNA, 30 pmols of each primer, 1.5 mM MgCl₂, 200 µ M dNTP, and 2.5 U Taq polymerase (Amersham Pharmacia Biotech). After the initial denaturation for 5 min at 95º C, samples were subjected to 40 cycles of 1 min at 95º C, 30 sec at 61º C annealing temperature, 3 min at 72º C extension, followed by a final extension step of 10 min at 72º C.

The PCR products were submitted to digestion with the restriction enzymes Nco I for detection of the Trp8Arg point mutation and with Fok I for detection of the Ile15Thr point mutation, according to the manufacturer's protocol (New England Biolabs, USA). The Nco I digestion of PCR products produced 3 bands of 1050, 575, and 100 bp in TT homozygous subjects, 2 bands of 1150 and 575 bp in CC homozygous subjects, and 4 bands of 1150, 1050, 575, and 100 bp in heterozygous subjects. The PCR products digested with Fok I produced 9 bands of 500, 392, 304, 195, 108, 71, 43, 40, and 11 bp in TT homozygous subjects; 8 bands of 500, 435, 304, 195, 108, 71, 40, and 11 bp in CC homozygous subjects; and 10 bands of 500, 435, 392, 304, 195, 108, 71, 43, 40, and 11 in heterozygous subjects. The point mutations were confirmed by direct sequencing using an ABI PRISM 3100 Genetic Analyzer automatic DNA sequencer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA).

Hormonal assays

Basal LH, FSH, estradiol, and testosterone levels were measured in 37 healthy subjects (21 women with chronological age (CA) of 35.4 ± 6.9 years and 16 men with CA of 33.6 ± 12.6 years) and in 27 HH patients (13 women with CA of 19.0 ± 7.3 years and bone age (BA) of 11.9 ± 3.4 years, and 14 men with CA of 20.5 ± 4.0 years and BA of 14.1 ± 2.0 years).

Serum LH and FSH concentrations were determined by commercial, solid phase, 2-site fluoroimmunometric assay (AutoDELFIA hLH Spec and AutoDELFIA hFSH Spec, Wallac Oy, Turku, Finland), based on the direct sandwich technique. This assay uses 2 monoclonal antibodies against the LH b-subunit and should detect this LH variant.

Estradiol and testosterone were measured by commercial solid phase fluoroimmunoassay (AutoDELFIA Estradiol and AutoDELFIA Testosterone, Wallac Oy, Turku, Finland) using polyclonal antibodies. Normal reference values for gonadotropins, testosterone, and estradiol were based on previously reported data.²⁸

Statistical analysis

The data are expressed as mean ± SD. The genotypic and allelic frequencies of the LH variant between normal and HH groups were analyzed with the use of the chi-square test and a P < .05 was considered statistically significant.

RESULTS

The allelic variant Arg8/Thr15 of LH b-subunit gene was found in 29/202 (14.4%) of the healthy subjects and 8/48 (16.6%) of the patients with HH. The frequency of the C allele was not significantly different (P = 0.996) between healthy subjects and patients with HH (Table 1).

There was no effect of the allelic variant of the LH b-subunit gene on LH levels in healthy subjects compared to LH levels in patients with hypogonadotropic hypogonadism (HH) (Table 2).

DISCUSSION

There have been speculative suggestions that the allelic variant Arg8/Thr15 of the LH b-subunit gene may correlate with the changes in the pituitary-gonadal function^13,18,19,22 and menstrual disorders.^14,26 Our study indicates that the allelic variant Arg8/Thr15 of the LH b-subunit gene is a polymorphism that is also commonly found in the Brazilian population. The frequency of this allelic variant in the group with hypogonadotropic hypogonadism (16.6%) was similar to that of the healthy subjects (14.4%), excluding a relationship between the variant and hypogonadism.

This allelic variant is not detectable by immunoradiometric assay using highly specific monoclonal antibodies against the intact LH molecule.^6,15-17 This possibility should be kept in mind when inappropriately low levels of gonadotropins are detected in routine diagnostic tests with this kind of assay. In our study, using specific immunofluorometric assay with 2 antibodies against the LH b-subunit, no interference was observed on LH levels in the control group, nor in the HH group.

In conclusion, the allelic variant Trp8Arg/Ile15Thr of the LH b-subunit is a common polymorphism in several populations including Brazilians. The similar prevalence of this allelic variant in both HH and healthy subject groups excludes a role of this variant in the etiology of HH.

ACKNOWLEDGMENTS

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) which provided grants to BBM (301246/95-5) and IJPA (303444/02-9).

Received for publication on June 22, 2005

Accepted for publication on August 17, 2005

• 1. Pierce JG, Parsons TF. Glycoprotein hormones: structure and function. Annu Ver Biochem. 1981;50:465-95.
• 2. Gharib SD, Wierman ME, Shupnik MA, Chin WW. Molecular biology of the pituitary gonadotropins. Endocr Rev. 1990;11:177-99.
• 3. Ward DN, Perry WM, Bousfield GR. Gonadotropins: chemistry and biosynthesis. In Knobil E and Neill JD. The physiology of reproduction. 2nd ed. New York: Raven Press;1994.p.1749.
• 4. Reader SC, Robertson WR, Diczfaluzy E. Microheterogeneity of luteinizing hormone in pituitary glands from women of pre- and postmenopausal age. Clin Endocrinol (Oxf). 1983;19:355-63.
• 5. Pettersson K, Ding Y-Q, Huhtaniemi I. An immunologically anomalous luteinizing hormone variant in a healthy woman. J Clin Endocrinol Metab. 1992;74:164-71.
• 6. Pettersson K, Mäkela MM, Dahlén P, Lamminen T, Huoponem K, Huhtaniemi I; 1994. Gene polymorphism found in the LH beta gene of an immunologically anomalous variant of human luteinizing hormone. Eur J Endocrinol. 1994;130(suppl 2) Abstract S17.03.
• 7. Talmadge K, Vamvakopoulos NC, Fiddes JC. Evolution of the genes for the beta subunits of human chorionic gonadotropin and luteinizing hormone. Nature. 1984;307:37-40.
• 8. Hollenberg NA, Pestell RG, Albanese C, Boers ME, Jameson JL. Multiple promoter elements in the human chorionic gonadotropin beta subunit genes distinguish their expression from the luteinizing hormone beta gene. Mol Cell Endocrinol. 1994;106:111-9.
• 9. Weiss J, Axelrod L, Whitcomb RW, Crowley WF, Jameson JL. Hypogonadism caused by a single amino acid substitution in the b subunit of luteinizing hormone. N Engl J Med. 1992;326:179-83.
• 10. Beckers A, Pralong PF, Tebeu P, Quarresooz P, Gaillard RC, Daly AF, et al. Hypogonadism in a patient with a mutation in the luteinizing hormone beta-subunit gene. N Engl J Med. 2004;351(25):2619-25.
• 11. Roy AC, Liao WX, Chen Y, Arulkumaran S, Ratnan SS. Identification of seven novel mutations in LH b-subunit gene by SSCP. Mol Cell Biochem. 1996;165:151-3.
• 12. Liao WX, Roy AC, Chan C, Arulkumaran S, Ratnam SS. A new molecular variant of luteinizing hormone associated with female infertility. Fertil and Steril. 1998;69:102-6.
• 13. Ramanujam LN, Liao WX, Roy AC, Ng SC. Association of molecular variants of luteinizing hormone with male infertility. Hum Reprod. 2000;15(4):925-8.
• 14. Ramanujam LN, Liao WX, Roy AC, Loganath A, Goh HH, Ng SC. Association of molecular variants of luteinizing hormone with menstrual disorders. Clin Endocrinol. 1999;51(2):243-6.
• 15. Haavisto AM, Pettersson K, Bergendahl M, Virkamaki A, Huhtaniemi I. Occurrence and biological properties of a common genetic variant of luteinizing hormone. J Clin Endocrinol Metab. 1995;80:1257-63.
• 16. Furui K, Suganuma N, Tsukahara S, Asada Y, Kikkawa F, Tanaka M, et al. Identification of two point mutations in the gene coding luteinizing hormone (LH) beta-subunit, associated with immunologically anomalous LH variants. J Clin Endocrinol Metab. 1994;78:107-13.
• 17. Okuda K, Yamada T, Imoto H, Komatsubara , Sugimoto O. Antigenic alteration of an anomalous human luteinizing hormone caused by two chorionic gonadotropin-type amino-acid substitutions. Biochem Biophys Res Commun. 1994;200:584-90.
• 18. Takahashi K, Karino K, Kanasaki H, Kurioka H, Ozaki T, Yonehara T, et al. Influence of missense mutation and silent mutation of LH beta-subunit gene in Japanese patients with ovulatory disorders. Eur J Hum Genet. 2003;11(5):402-8.
• 19. Lamminen T, Huhtaniemi I. A common genetic variant of luteinizing hormone; relation to normal and aberrant pituitary-gonadal function. European Journal Of Pharmacology. 2001;414:1-7.
• 20. Elter K, Erel CT, Cine N, Ozbek U, Hacihanefioglu B, Ertungealp E. Role of the mutations Trp8Arg and Ile15Thr of the human luteinizing hormone beta-subunit in women with polycystic ovary syndrome. Fertil and Steril. 1999;71:425-30.
• 21. Starka L, Hill M, Hampl R, Huhtaniemi IT. Genetic variant of luteinizing hormone in Czech Republic. Endocr Regul. 1999;33:103-8.
• 22. Takahashi K, Ozaki T, Okada M, Kurioka H, Kanasaki H, Miyazaki K. Increased prevalence of luteinizing hormone beta-subunit variant in patients with premature ovarian failure. Fertil and Steril. 1999;71:96-101
• 23. Takahashi K, Kurioka H, Ozaki T, Kanasaki H, Kohsaka M, Miyazaki K, et al. Increased prevalence of luteinizing hormone beta subunit variant in Japanese infertility patients. Hum Reprod. 1998;13:3338-44.
• 24. Ramanujam L, Liao WX, Roy AC, Ng SC, Ratnam SS. Molecular variants of luteinizing hormone in three populations of Southeast Asia. Hum Hered. 1998;48:232-4.
• 25. Nilsson C, Pettersson K, Millar RP, Coerver KA, Matzuk MM, Huhtaniemi I. Worldwide frequency of a common genetic variant of luteinizing hormone: an international collaborative research. International Collaborative Research Group. Fertil and Steril. 1997;67:998-1004.
• 26. Suganuma N, Furui K, Furuhashi M, Yoshimasa A, Fumitaka K, Yutaka T. Screening of the mutations in luteinizing hormone b-subunit in patients with menstrual disorders. Fertil and Steril. 1995;63(5):989-95.
• 27. Rajkhowa M, Talbot JA, Jones PW, Pettersson K, Haavisto AM, Huhtaniemi I, et al. Prevalence of an immunological LH beta subunit variant in UK population of healthy women and women with polycystic ovary syndrome. Clin Endocr. 1995;43:297-303.
• 28. Brito VN, Batista MC, Borges MF, Latronico AC, Kohek MB, Thirone AC, et al. Diagnostic value of fluorometric assays in the evaluation of precocious puberty. J Clin Endocrinol Metab. 1999,84(10):3539-44.

Publication Dates

• Publication in this collection
  12 Dec 2005
• Date of issue
  Dec 2005

History

• Received
  22 June 2005
• Accepted
  17 Aug 2005