Wolbachia pipientis: first detection in populations of Glycaspis brimblecombei (Hemiptera: Aphalaridae) and Psyllaephagus bliteus (Hymenoptera: Encyrtidae) in Brazil

Wolbachia pipientis: primeira detecção em populações de Glycaspis brimblecombei (Hemiptera: Aphalaridae) e Psyllaephagus bliteus (Hymenoptera: Encyrtidae) no Brasil

Abstract

The sucking insect, Glycaspis brimblecombei Moore (Hemiptera: Aphalaridae), is originally from Australia and reduces the productivity of Eucalyptus crops. The parasitoid Psyllaephagus bliteus Riek (Hymenoptera: Encyrtidae) is the main agent used in the integrated management of G. brimblecombei. Endosymbionts, in insects, are important in the adaptation and protection of their hosts to the environment. The intracellular symbionts Wolbachia, induces reproductive changes such as cytoplasmic incompatibility, feminization, male death and parthenogenesis. The objective of this study was to report the first record of Wolbachia pipientis in populations of G. brimblecombei and of its parasitoid P. bliteus in the field in Brazil. Branches with adults of G. brimblecombei and P. bliteus were collected from eucalyptus trees in commercial farms in six Brazilian states and, after emergence, the insects obtained were frozen at -20 °C. Polymerase chain reaction (PCR) was performed to detect the Wolbachia endosymbiont. Wolbachia pipientis was identified in individuals of G. brimblecombei and its parasitoid P. bliteus from populations of the counties of Agudos and Mogi-Guaçu (São Paulo State), Itamarandiba (Minas Gerais State) and São Jerônimo da Serra (Paraná State) in Brazil.

Keywords:
biological control; endosymbionts; red gum lerp psyllid

Resumo

O inseto sugador, Glycaspis brimblecombei Moore (Hemiptera: Aphalaridae), é de origem australiana e reduz a produtividade de cultivos do gênero Eucalyptus. O parasitoide Psyllaephagus bliteus Riek (Hymenoptera: Encyrtidae) é o principal agente utilizado no manejo integrado de G. brimblecombei. Endossimbiontes, em insetos, são importantes na adaptação e proteção de seus hospedeiros ao ambiente que habitam. Wolbachia, um simbionte intracelular, induz alterações reprodutivas, como feminização, incompatibilidade citoplasmática, morte de machos e partenogênese. O objetivo foi relatar o primeiro registro de Wolbachia pipientis em populações de G. brimblecombei e de seu parasitoide P. bliteus em campo no Brasil. Ramos com adultos de G. brimblecombei e P. bliteus foram coletados em árvores de eucalipto em plantios comerciais em seis estados do Brasil e, após a emergência, os insetos obtidos foram congelados -20 °C. A reação em cadeia da polimerase (PCR) foi realizada para detectar o endossimbionte Wolbachia. Wolbachia pipientis foi identificado em indivíduos de G. brimblecombei e de seu parasitoide P. bliteus de populações de Agudos e Mogi-Guaçu (São Paulo), Itamarandiba (Minas Gerais) e São Jerônimo da Serra (Paraná), Brasil.

Palavras-chave:
controle biológico; endossimbiontes; psilídeo-de-concha

1. Introduction

Glycaspis brimblecombei Moore (Hemiptera: Aphalaridae), of Australian origin, damages several species of the genus Eucalyptus (Dal-Pogetto et al., 2022). The easy adaptation, dispersion and the great extension of the areas planted with eucalyptus increase the importance of integrated pest management programs (Ndlela et al., 2018). The parasitoid Psyllaephagus bliteus Riek (Hymenoptera: Encyrtidae) is the main agent used in the integrated management of G. brimblecombei (Cuello et al., 2021).

Endosymbionts such as Wolbachia and Rickettsia have been reported in many insect species (Bryant and Newton, 2020; Milenovic et al., 2022). Endosymbionts are important in protecting hosts from environmental stress, such as natural enemies, heat and toxins (Liu and Guo, 2019). Wolbachia is an intracellular symbiont in reproductive tissues of arthropods and with maternal transmission. It can manipulate the reproduction of its hosts, inducing reproductive alterations, such as cytoplasmic incompatibility, feminization, male death and parthenogenesis to increase its transmission and persistence in the environment (Rocha et al., 2018; Bagheri et al., 2019; Mateos et al., 2020). Maternal transmission, Wolbachia's reproductive advantage, can block the transmission of pathogens (Krafsur et al., 2020) and influence insect fitness (Cao et al., 2019), important variables in the rearing of natural enemies.

Relationships between endosymbionts, G. brimblecombei and its parasitoid P. bliteus are poorly studied and may improve the understanding of protecting and reproducing these insects. The objective was to report Wolbachia pipientis for the first time in populations of Glycaspis brimblecombei and of its parasitoid Psyllaephagus bliteus in the field in Brazil.

2. Material and Methods

2.1. Obtaining samples

Branches infested with G. brimblecombei and its parasitoid P. bliteus were collected from eucalyptus trees in commercial farms between May 2017 and March 2019 in six Brazilian states (Table 1). Individuals of the pest and its parasitoid, after emergence, were frozen at -20 °C.

Table 1
Populations (Pop.), hosts, Eucalyptus camaldulensis (E.c), Eucalyptus grandis × Eucalyptus camaldulensis (E.g × E.c) and E. grandis × Eucalyptus urophylla (E.g × E.u), latitude, longitude, place and year of collections (Year) of Glycaspis brimblecombei (Hemiptera: Aphalaridae) (G.b.) and of its parasitoid Psyllaephagus bliteus (P.b.) (Hymenoptera: Encyrtidae) in the states of Goiás (GO), Maranhão (MA), Mato Grosso do Sul (MS), Minas Gerais (MG), Paraná (PR) and São Paulo (SP), Brazil between 2017 and 2019

Pop.	Hosts	Latitude	Longitude	Collection location	Year
1 G.b.	E.c	-22.82352	-48.43146	Botucatu, SP	2017
2 G.b.	E.g × E.u	-22.35065	-46.97842	Mogi-Guaçú, SP	2017
3 G.b.	E.g × E.u	-22.81269	-48.15861	Anhembi, SP	2018
4 G.b.	E.g × E.u	-22.4694	-48.59221	Agudos, SP	2019
5 G.b.	E.g × E.u	-22.77489	-48.35739	Botucatu, SP	2019
6 G.b.	E.g × E.u	-20.51734	-51.75398	Três Lagoas, MS	2017
7 G.b.	E.g × E.u	-17.8164	-42.90058	Itamarandiba, MG	2018
8 G.b.	E.g × E.u	-14.16676	-48.34232	Niquelândia, GO	2018
9 G.b.	E.g × E.c	-23.74529	-50.76339	São Jerônimo da Serra, PR	2019
10 G.b.	E.g × E.u	-5.19567	-47.5584	Trecho Seco, MA	2019
11 P.b.	E.c	-22.82352	-48.43146	Botucatu, SP	2017
12 P.b.	E.g × E.u	-22.35065	-46.97842	Mogi-Guaçú, SP	2017
13 P.b.	E.g × E.u	-22.45275	-48.92557	Agudos, SP	2019
14 P.b.	E.g × E.u	-20.51734	-51.75398	Três Lagoas, MS	2017
15 P.b.	E.g × E.u	-16.59597	-44.01011	Montes Claros, MG	2017
16 P.b.	E.g × E.u	-17.8164	-42.90058	Itamarandiba, MG	2018
17 P.b.	E.g× E.c	-23.74529	-50.76339	São Jerônimo da Serra, PR	2019

2.2. Genomic DNA extraction

Genomic DNA was extracted from 20 adults from each population of G. brimblecombei and P. bliteus. These adults were macerated in a solution of 40 μl of 10% Chelex 100 resin (Bio-Rad Laboratories) and 4 μl of proteinase K (20 mg/mL) (Walsh et al., 1991). Samples of these adults were placed in a thermal block at 95 °C for 20 min. and the supernatant collected, after this period, for the polymerase chain reaction (PCR).

2.3. Polymerase chain reaction (PCR)

The Wolbachia endosymbiont was detected in PCR consisting of 12.5 μl of Gotaq, 7.5 μl of nuclease-free water, 1.0 μl of each primer (F: CGGGGGAAAAATTTATTGCT and R: AGCTGTAATACAGAAAGTAAA) (Heddi et al., 1999) and 3.0 μl of genomic DNA, totaling 25 μl per reaction. The PCR condition was 95 °C for (3'), followed by 30 cycles: 95 °C (30”), 55 °C (30”) and 72 °C (30”) and a final extension of 72 °C for 5' performed in an INFINIGEN thermal cycler (model TC-96CG). The expected length of the fragment is 900 bp. PCR products were visualized in 1% agarose gel with 100 bp molecular marker (Norgen) in ultraviolet light transilluminator (Major Science). DNA extraction procedures were performed at the Laboratory of Molecular Biology and Nematology of the Faculdade de Ciências Agronômicas (FCA), Universidade Estadual Paulista “Júlio de Mesquita Filho” (UNESP), in Botucatu, São Paulo, Brazil.

2.4. DNA purification and Sanger sequencing

PCR products were purified using the PCR Purification Kit (Cellco, Cat.DPK-106S) following the manufacturer's recommendations. Amplifications were sequenced by an automated DNA Sanger sequencer (Model: ABI 3500- Applied Biosystems) at the Instituto de Biotecnologia (IBTEC/UNESP) in Botucatu, São Paulo, Brazil. The sequences obtained were compared and deposited in the GenBank database (NCBI, 2022) for the identification of genetic similarity of the researched endosymbionts.

3. Results

The facultative endosymbiont W. pipientis was sequenced with a 900 bp fragment and two sequences were obtained, one sequence identified in G. brimblecombei (GenBank accession MW079901), with sequencing coverage of 100% identity for W. pipientis (closest GenBank accession MN123211.1), and the other sequence in its parasitoids P. bliteus (GenBank accession MW086624.1), with sequencing coverage of 99% (closest GenBank accession MW727486.1), in the populations of Agudos and Mogi-Guaçu (São Paulo), Itamarandiba (Minas Gerais) and São Jerônimo da Serra (Paraná), Brazil.

4. Discussion

The identification of the endosymbiont W. pipientis in different populations of G. brimblecombei and of its parasitoid P. bliteus is similar to that reported for species of the order Hemiptera, such as Laodelphax striatellus Fallén (Delphacidae) (Bing et al., 2020) and Oxycarenus laetus Kirby (Lygaeidae) (Sureshan et al., 2022) and Hymenoptera, such as Trichogramma dendrolimi Matsumura (Trichogrammatidae) (Liu et al., 2018) and Anagyrus vladimiri Triapitsyn (Encyrtidae) (Izraeli et al., 2021). This is due to the co-evolution between W. pipientis and its hosts, with a variety of mutual adaptations (Shaikevich et al., 2019; Bi and Wang, 2020; Burdina and Gruntenko, 2022). The presence of W. pipientis can reduce the number of offspring, shorten the life cycle, kill males, cause parthenogenesis and feminization, and increase female reproduction and male fertility (Driscoll et al., 2020; Singh and Linksvayer, 2020), such as reported for Empoasca onukii Matsuda (Hemiptera: Cicadellidae) (Zhang et al., 2021). In addition, it may also increase host resistance to stress and viral infection, as reported for Aedes fluviatilis Lutz (Diptera: Culicidae) (Silva et al., 2022). The presence of Wolbachia can also cause cytoplasmic incompatibility, when an infected male fertilizes an uninfected female and causes the death of the embryos (Arai et al., 2019; Xiao et al., 2021). The presence of Wolbachia did not benefit A. vladimiri in mass rearing in the laboratory (Izraeli et al., 2021).

The presence of W. pipientis is the first report of this bacterium in different populations of G. brimblecombei and P. bliteus in Brazil, and may serve to develop tools to increase the efficiency of rearing this pest and of its natural enemy in integrated pest management programs.

Acknowledgements

To the Brazilian institutions “Conselho Nacional de Desenvolvimento Cientifico e Tecnológico (CNPq)”, “Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES-Finance Code 001)”, “Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG)” and “Programa Cooperativo sobre Proteção Florestal (PROTEF) do Instituto de Pesquisas e Estudos Florestais (IPEF)” for financial support.

References

• ARAI, H., HIRANO, T., AKIZUKI, N., ABE, A., NAKAI, M., KUNIMI, Y. and INOUE, M.N., 2019. Multiple infection and reproductive manipulations of Wolbachia in Homona magnanima (Lepidoptera: tortricidae). Microbial Ecology, vol. 77, no. 1, pp. 257-266. http://dx.doi.org/10.1007/s00248-018-1210-4 PMid:29931623.
  » http://dx.doi.org/10.1007/s00248-018-1210-4
• BAGHERI, Z., TALEBI, A.A., ASGARI, S. and MEHRABADI, M., 2019. Wolbachia induce cytoplasmic incompatibility and affect mate preference in Habrobracon hebetor to increase the chance of its transmission to the next generation. Journal of Invertebrate Pathology, vol. 163, pp. 1-7. http://dx.doi.org/10.1016/j.jip.2019.02.005 PMid:30807733.
  » http://dx.doi.org/10.1016/j.jip.2019.02.005
• BI, J. and WANG, Y.F., 2020. The effect of the endosymbiont Wolbachia on the behavior of insect hosts. Insect Science, vol. 27, no. 5, pp. 846-858. http://dx.doi.org/10.1111/1744-7917.12731 PMid:31631529.
  » http://dx.doi.org/10.1111/1744-7917.12731
• BING, X.L., ZHAO, D.S., SUN, J.T., ZHANG, K.J. and HONG, X.Y., 2020. Genomic analysis of Wolbachia from Laodelphax striatellus (Delphacidae, Hemiptera) reveals insights into its “Jekyll and Hyde” mode of infection pattern. Genome Biology and Evolution, vol. 12, no. 2, pp. 3818-3831. http://dx.doi.org/10.1093/gbe/evaa006 PMid:31958110.
  » http://dx.doi.org/10.1093/gbe/evaa006
• BRYANT, K.N. and NEWTON, I.L., 2020. The intracellular symbiont Wolbachia pipientis enhances recombination in a dose-dependent manner. Insects, vol. 11, no. 5, pp. 284. http://dx.doi.org/10.3390/insects11050284 PMid:32384776.
  » http://dx.doi.org/10.3390/insects11050284
• BURDINA, E.V. and GRUNTENKO, N.E., 2022. Physiological aspects of Wolbachia pipientis–Drosophila melanogaster relationship. Journal of Evolutionary Biochemistry and Physiology, vol. 58, no. 2, pp. 303-317. http://dx.doi.org/10.1134/S0022093022020016
  » http://dx.doi.org/10.1134/S0022093022020016
• CAO, L.J., JIANG, W. and HOFFMANN, A.A., 2019. Life history effects linked to an advantage for wAu Wolbachia in Drosophila. Insects, vol. 10, no. 5, pp. 126. http://dx.doi.org/10.3390/insects10050126
  » http://dx.doi.org/10.3390/insects10050126
• CUELLO, E.M., ANDORNO, A.V., HERNÁNDEZ, C.M. and LÓPEZ, S.N., 2021. Phenology, parasitism and density dependence of Psyllaephagus bliteus on Eucalyptus camaldulensis. Phytoparasitica, vol. 49, no. 4, pp. 561-568. http://dx.doi.org/10.1007/s12600-020-00880-x
  » http://dx.doi.org/10.1007/s12600-020-00880-x
• DAL-POGETTO, M.H.F.A., TAVARES, W.S., ZANUNCIO, J.C., SILVA, W.M., MASSON, M.V., FERREIRA-FILHO, P.J., BARBOSA, L.R. and WILCKEN, C.F., 2022. High population levels lead Glycaspis brimblecombei (Hemiptera: Aphalaridae) to unrecorded feeding and oviposition behaviors on Eucalyptus urograndis plants. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 84, e250931. http://dx.doi.org/10.1590/1519-6984.250931
  » http://dx.doi.org/10.1590/1519-6984.250931
• DRISCOLL, T.P., VERHOEVE, V.I., BROCKWAY, C., SHREWSBERRY, D.L., PLUMER, M., SEVDALIS, S.E., BECKMANN, J.F., KRUEGER, L.M., MACALUSO, K.R., AZAD, A.F. and GILLESPIE, J.J., 2020. Evolution of Wolbachia mutualism and reproductive parasitism: insight from two novel strains that co-infect cat fleas. PeerJ, vol. 8, e10646. http://dx.doi.org/10.7717/peerj.10646 PMid:33362982.
  » http://dx.doi.org/10.7717/peerj.10646
• HEDDI, A., GRENIER, A.M., KHATCHADOURIAN, C., CHARLES, H. and NARDON, P., 1999. Four intracellular genomes direct weevil biology: nuclear, mitochondrial, principal endosymbiont, and Wolbachia. Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 12, pp. 6814-6819. http://dx.doi.org/10.1073/pnas.96.12.6814 PMid:10359795.
  » http://dx.doi.org/10.1073/pnas.96.12.6814
• IZRAELI, Y., LALZAR, M., NETANEL, N., MOZES-DAUBE, N., STEINBERG, S., CHIEL, E. and ZCHORI-FEIN, E., 2021. Wolbachia influence on the fitness of Anagyrus vladimiri (Hymenoptera: Encyrtidae), a bio‐control agent of mealybugs. Pest Management Science, vol. 77, no. 2, pp. 1023-1034. http://dx.doi.org/10.1002/ps.6117 PMid:33002324.
  » http://dx.doi.org/10.1002/ps.6117
• KRAFSUR, A.M., GHOSH, A. and BRELSFOARD, C.L., 2020. Phenotypic response of Wolbachia pipientis in a cell-free medium. Microorganisms, vol. 8, no. 7, pp. 1060. http://dx.doi.org/10.3390/microorganisms8071060 PMid:32708688.
  » http://dx.doi.org/10.3390/microorganisms8071060
• LIU, Q.Q., ZHANG, T.S., LI, C.X., GU, J.W., HOU, J.B. and DONG, H., 2018. Decision‐making in a bisexual line and a thelytokous Wolbachia‐infected line of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) regarding behavior toward their hosts. Pest Management Science, vol. 74, no. 7, pp. 1720-1727. http://dx.doi.org/10.1002/ps.4867 PMid:29363888.
  » http://dx.doi.org/10.1002/ps.4867
• LIU, X.D. and GUO, H.F., 2019. Importance of endosymbionts Wolbachia and Rickettsia in insect resistance development. Current Opinion in Insect Science, vol. 33, pp. 84-90. http://dx.doi.org/10.1016/j.cois.2019.05.003 PMid:31358201.
  » http://dx.doi.org/10.1016/j.cois.2019.05.003
• MATEOS, M., MARTINEZ MONTOYA, H., LANZAVECCHIA, S.B., CONTE, C., GUILLÉN, K., MORÁN-ACEVES, B.M., TOLEDO, J., LIEDO, P., ASIMAKIS, E.D., DOUDOUMIS, V., KYRITSIS, G.A., PAPADOPOULOS, N.T., AUGUSTINOS, A.A., SEGURA, D.F. and TSIAMIS, G., 2020. Wolbachia pipientis associated with tephritid fruit fly pests: from basic research to applications. Frontiers in Microbiology, vol. 11, pp. 1080. http://dx.doi.org/10.3389/fmicb.2020.01080 PMid:32582067.
  » http://dx.doi.org/10.3389/fmicb.2020.01080
• MILENOVIC, M., GHANIM, M., HOFFMANN, L. and RAPISARDA, C., 2022. Whitefly endosymbionts: IPM opportunity or tilting at windmills? Journal of Pest Science, vol. 95, no. 2, pp. 543-566. http://dx.doi.org/10.1007/s10340-021-01451-7 PMid:34744550.
  » http://dx.doi.org/10.1007/s10340-021-01451-7
• NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION – NCBI [online], 2022 [viewed 30 May 2022]. Available from: http://www.ncbi.nlm.nih.gov
  » http://www.ncbi.nlm.nih.gov
• NDLELA, S., MANYANGADZE, T., SACHISUKO, A., LINGEN, S. and MAKOWE, I.A., 2018. The distribution and management of two invasive pests of Eucalyptus: the red gum lerp psyllid, Glycaspis brimblecombei (Hemiptera: Psylloidae), and the blue gum chalcid wasp, Leptocybe invasa (Hymenoptera: Eulophidae), in Zimbabwe. African Entomology, vol. 26, no. 1, pp. 104-115. http://dx.doi.org/10.4001/003.026.0104
  » http://dx.doi.org/10.4001/003.026.0104
• ROCHA, N.O., LAMBERT, S.M., DIAS‐LIMA, A.G., JULIÃO, F.S. and SOUZA, B.M.P.S., 2018. Molecular detection of Wolbachia pipientis in natural populations of sandfly vectors of Leishmania infantum in endemic areas: first detection in Lutzomyia longipalpis. Medical and Veterinary Entomology, vol. 32, no. 1, pp. 111-114. http://dx.doi.org/10.1111/mve.12255 PMid:28799248.
  » http://dx.doi.org/10.1111/mve.12255
• SHAIKEVICH, E., BOGACHEVA, A., RAKOVA, V., GANUSHKINA, L. and ILINSKY, Y., 2019. Wolbachia symbionts in mosquitoes: intra-and intersupergroup recombinations, horizontal transmission and evolution. Molecular Phylogenetics and Evolution, vol. 134, pp. 24-34. http://dx.doi.org/10.1016/j.ympev.2019.01.020 PMid:30708172.
  » http://dx.doi.org/10.1016/j.ympev.2019.01.020
• SILVA, J.N., CONCEIÇÃO, C.C., BRITO, G.C.R., SANTOS, D.C., SILVA, R.M., ARCANJO, A., SORGINE, M.H.F., OLIVEIRA, P.L., MOREIRA, L.A., VAZ-JUNIOR, I.S. and LOGULLO, C., 2022. Wolbachia pipientis modulates metabolism and immunity during Aedes fluviatilis oogenesis. Insect Biochemistry and Molecular Biology, vol. 146, pp. 103776. http://dx.doi.org/10.1016/j.ibmb.2022.103776 PMid:35526745.
  » http://dx.doi.org/10.1016/j.ibmb.2022.103776
• SINGH, R. and LINKSVAYER, T.A., 2020. Wolbachia-infected ant colonies have increased reproductive investment and an accelerated life cycle. The Journal of Experimental Biology, vol. 223, no. Pt 9, pp. jeb220079. http://dx.doi.org/10.1242/jeb.220079 PMid:32253286.
  » http://dx.doi.org/10.1242/jeb.220079
• SURESHAN, S.C., MOHIDEEN, H.S. and NAIR, T.S., 2022. Gut metagenomic profiling of gossypol induced Oxycarenus laetus (Hemiptera: Lygaeidae) reveals gossypol tolerating bacterial species. Indian Journal of Microbiology, vol. 62 no. 1, pp. 54-60. http://dx.doi.org/10.1007/s12088-021-00964-0 PMid:35068604.
  » http://dx.doi.org/10.1007/s12088-021-00964-0
• WALSH, P.S., METZGER, D.A. and HIGUCHI, R., 1991. Chelex-100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques, vol. 10, no. 4, pp. 506-513. http://dx.doi.org/10.2144/000114018 PMid:1867860.
  » http://dx.doi.org/10.2144/000114018
• XIAO, Y., CHEN, H., WANG, H., ZHANG, M., CHEN, X., BERK, J.M., ZHANG, L., WEI, Y., LI, W., CUI, W., WANG, F., WANG, Q., CUI, C., LI, T., CHEN, C., YE, S., ZHANG, L., JI, X., HUANG, J., WANG, W., WANG, Z., HOCHSTRASSER, M. and YANG, H., 2021. Structural and mechanistic insights into the complexes formed by Wolbachia cytoplasmic incompatibility factors. Proceedings of the National Academy of Sciences of the United States of America, vol. 118, no. 41, e2107699118. http://dx.doi.org/10.1073/pnas.2107699118 PMid:34620712.
  » http://dx.doi.org/10.1073/pnas.2107699118
• ZHANG, Q., LAN, R., JI, D., TAN, Y., ZHOU, X., TAN, X., WU, Q. and JIN, L., 2021. The detection of Wolbachia in tea green leafhopper (Empoasca onukii Matsuda) and its influence on the host. Agriculture, vol. 12, no. 1, pp. 36. http://dx.doi.org/10.3390/agriculture12010036
  » http://dx.doi.org/10.3390/agriculture12010036

Publication Dates

• Publication in this collection
  23 Sept 2022
• Date of issue
  2022

History

• Received
  30 May 2022
• Accepted
  05 Sept 2022