PREX2 gene’s expression in gastric antral epithelial cells of patients with H. pylori infection

Expressão do gene PREX2 em células epiteliais antrais gástricas em pacientes com infecção por H. pylori

ABSTRACT

BACKGROUND:

The Prex2 protein is a member of the Rac family proteins that belongs to small G proteins with a critical role in cell migration, cell proliferation, and apoptosis through its effects on PI3K cell signaling pathway and phosphatase activity of PTEN protein. The effect of PREX2 gene expression has been shown in some cancer cells. A survey of PREX2 gene expression in gastric antral epithelial cells of gastric cancer patients with Helicobacter pylori various genotypes infection can conduct to better understanding H. pylori infection’s carcinogenesis.

METHODS:

In a case-control study, PREX2 gene expression was evaluated in gastric antral biopsy samples on four groups of patients referred to Sanandaj hospitals, including gastritis with (n=23) and without (n=27) H. pylori infection and gastric cancer with (n=21) and without (n=32) H. pylori infection. Each gastric biopsy sample’s total RNA was extracted and cDNA synthesized by using Kits (Takara Company). The PREX2 gene expression was measured using the relative quantitative real-time RT-PCR method and ΔΔCt formula.

RESULTS:

The PREX2 gene expression increased in gastric antral biopsy samples of gastritis and gastric cancer patients with H. pylori infection (case groups) than patients without H. pylori infection (control groups) 2.38 and 2.27 times, respectively. The patients with H. pylori vacA s1m1 and sabB genotypes infection showed a significant increase of PREX2 gene expression in gastric cancer antral epithelial cells.

CONCLUSION:

H. pylori vacA s1m1 and sabB genotypes have the positive correlations with PREX2 gene expression in gastric antral epithelial cells of gastritis and gastric cancer patients.

Keywords:
Gastritis; gastric cancer; PREX2; Helicobacter pylori; virulence genes; real-time RT-PCR

RESUMO

CONTEXTO:

A proteína Prex2 é membro das proteínas da família Rac que pertencem a pequenas proteínas G com um papel crítico na migração celular, na proliferação celular e na apoptose através de seus efeitos na via de sinalização celular PI3K e atividade fosfatase da proteína PTEN. O efeito da expressão genética PREX2 tem sido mostrada em algumas células cancerosas. Um levantamento da expressão genética PREX2 em células epiteliais antrais gástricas de pacientes infectados com vários genótipos de Helicobacter pylori pode conduzir a um melhor entendimento da carcinogênese da infecção por H. pylori.

MÉTODOS:

Em estudo de caso-controle, a expressão genética PREX2 foi avaliada em amostras de biópsia antral gástrica em quatro grupos de pacientes encaminhados aos hospitais de Sanandaj, incluindo gastrite com (n=23) e sem (n=27) infecção por H. pylori e de câncer gástrico com (n=21) e sem (n=32) infecção por H. pylori. O RNA total de cada amostra de biópsia gástrica foi extraído e cDNA sintetizado por meio de kits (Takara Company). A expressão genética PREX2 foi medida utilizando-se o método RT-PCR em tempo real quantitativo relativo e a fórmula ΔΔCt.

RESULTADOS:

A expressão genética PREX2 aumentou em amostras de biópsia antral gástrica de pacientes com gastrite e câncer gástrico com infecção por H. pylori (grupos de casos) em relação aos sem infecção por H. pylori (grupos de controle) 2,38 e 2,27 vezes, respectivamente. Os pacientes com infecção por genótipos H. pylori vacA s1m1 e sabB apresentaram um aumento significativo da expressão genética PREX2 em células epiteliais antrais de câncer gástrico.

CONCLUSÃO:

Os genótipos H. pylori vacA s1m1 e sabB têm correlações positivas com a expressão genética PREX2 em células epiteliais antrais gástricas de pacientes com câncer gástrico e gastrites.

Palavras-chave:
Gastrite; câncer gástrico; PREX2; Helicobacter pylori; genes de virulência; RT-PCR em tempo real

INTRODUCTION

Helicobacter pylori is the most common cause of human chronic bacterial infection with a high global prevalence¹. On average, since past until now, H. pylori has infected over half of the world’s population and causes various stomach diseases, including gastritis, peptic ulcers, and gastric cancer¹. 15% of the people with H. pylori’s chronic active infection progress to gastric cancer². The prevalence of H. pylori infection and gastric cancer in countries wordwide has been reported differently². The rate of H. pylori infection and gastric cancer prevalences are high in Iran, a country in the Middle East, and have been reported up to 69% and 1% of the total Iranian population, respectively². Concerning H. pylori complicated interaction with the gastric antral epithelial cells, knowing the cellular and molecular mechanisms of the H. pylori long-term survival in the human stomach and causing cancer are still the most controversial issues^3,4.

H. pylori has a dozen virulence factors, including toxins, enzymes, and adhesins, that mediate bacterial pathogenesis⁵. The VacA (vacuolating cytotoxin A) and CagA proteins are the H. pylori main secretory virulence factor⁵. Numerous studies show that the cagA gene, located in the H. pylori cag pathogenicity islands, codes a pathogenicity critical determining factor, mainly involved in gastric epithelial cell damage, including tumorigenesis^6,7. The VacA triggers apoptosis’s internal pathway in gastric epithelial cells by releasing cytochrome C from the mitochondria^8,9. The previous studies have shown antagonistic effects between VacA toxin and cagA protein effects through host cell proliferation changes¹⁰. H. pylori adhesin agents involve a wide range of bacterial surface proteins, including HopQ, HopS (BabA), HopC (AlpA), HopH (OipA), HopP (SabA), HopZ that bind the bacterium to the host cell^11,12. An exciting aspect of the H. pylori infection is a persistent and long-term infection in interaction with the host mucosal immune system through regulating and altering its adhesin proteins’ expression^11,13. As a case in point, the interaction of SabA protein and its ligand increases H. pylori colonization¹⁴. SabB protein, another sab allele, is a homolog of SabA protein that its inactivation is associated with the duodenal ulcer but not the gastric ulcers¹⁵.

H. pylori triggers a set of cell signalings, ultimately cause pathogenesis by changing the host cell skeleton and the expression of proinflammatory genes^9,16-18. A complicated network of intermediate molecules has been identified as the gastric epithelial cells messengers that involve response to H. pylori infection¹⁶. Prex (phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor) proteins belong to the large family of GEFs (guanine nucleotide exchange factors) that regulate the Rho/Rac family of GTPs that control cell signaling using the phosphatidylinositol 3-kinase (PI3K) pathway¹⁹. The PREX2 gene is located on chromosome 8 (8q13.2) in cancer and metastasis locus that its genes control cell proliferation and cell migration¹⁹. The previous studies show that Prex proteins are involved in several neoplasms’ physiology^20-24.

Considering the high prevalence of gastric cancer and H. pylori infection in Kurdistan province, located in the West of Iran, and the known role of the PREX2 gene in regulating cell proliferation, the survey PREX2 gene expression in gastric antral epithelial cells of gastric cancer patients with H. pylori infection can shed more light on the H. pylori carcinogenesis.

METHODS

A case-control study was designed using Cochran’s sampling formula and gastric carcinoma patients’ prevalence in Sanandaj city^25,26. 53 gastric carcinoma patients and 50 gastritis patients were introduced to the study, including 21 and 23 gastritis and gastric carcinoma patients with H. pylori infection as the case groups. The patients without H. pylori infection were considered as the control groups. After diagnosing diseases by a gastroenterologist, the patient selection was made by a sequential and available method. Patients treated with antibiotics, alcohol, and tobacco consumption was excluded from the study. After receiving patients’ consents and observing medical ethics, demographic characteristics, including age, sex, and geographic locations, were registered in the questionnaires. Diagnosis of H. pylori active infection was performed using the urease breath test. A gastric antral epithelial cell specimen was collected from each patient referred to Tohid and Shahid Ghazi hospitals of Sanandaj city for 18 months from September 2018 to March 2019. The gastric antral epithelial cells biopsy specimen of each patient was dropped in 1cc RNALater solutions vials (Roche Co.). The biopsy specimens were transferred to the Department of Microbiology research laboratory, Kurdistan University of Medical Sciences.

The H. pylori virulence and PREX2 gene primers were designed by primer 3 online software (Table 1 and 2). For each gastric antral biopsy sample, total RNA was extracted. H. pylori virulence and PREX2 genes cDNAs were synthesized using the Takara kits. The PCR method was used with vacA s2 genes’ specific primers to confirm H. pylori cDNAs. After sequencing, the vacA s2 PCR product was registered in GenBank with accession number MK642592.1. The H. pylori virulence genes cDNAs profile was detected using specific primers and the Gradient Thermocycler PCR method (Biorad company, Germany). PCR master mix for each sample was included buffer 10X (2.5 microlitre), DNA Taq polymerase 5 U/microliter (0.25 microlitre), dNTPs 10 mM (0.5 microlitre), MgCl² 50 mM (1 microlitre), cDNA (2 microlitre), forward and reverse specific primers 10 picoliter (each one 0.5 microlitre) and RNase-free water (17.75 microlitre) in final volume 25 microlitre. The thermal cycling PCR steps were involved an initial denaturation at 94°C for 5 minutes, a denaturation at 94°C for 30 seconds, a primer annealing for 45 seconds (primers temperatures have been shown in Table 1), an extension at 72°C for 45 seconds, and a final extension at 72°C for 5 minutes.

TABLE 1
The forward and reverse specific primers of H. pylori virulence genes with significant effects on PREX2 gene expression in patients’ gastric antral epithelial cells.

Specific primers	Sequence	Anealing (°C)	product length (bp)	Ref
vacA s1/s2 F	ATGGAAATACAACAAACACAC	55	259/286	Atherton et al.9
vacA s1/s2 R	CTGCTTGAATGCGCCAAAC
vacA m1/m2 F	TGGATAGTGCGACTGGGTTT	54	205/220	this study
vacA m1/m2 R	TCCATGCGGTTGTTGTTGTT
sabA F	TCTCTCGCTTGCGGTATCAT	56	204	this study
sabA R	AGCTCAATGTTGTTGGCGTT
TsabB F	GCATTCAAACGGCGAACAAC	56	248	this study
sabB R	TCCTGTGCAGTTCCCATCTT

The PREX2 and GAPDH (reference gene) genes’ expression in gastric antral biopsy samples of gastritis and gastric carcinoma patients with and without H. pylori infection were evaluated by the Corbett real-time PCR machine (rotor gene 6000 software) and Takara kit (One Step PrimeScriptTM RT-PCR) based on manufactures. Real-time PCR master mix was included buffer 10X (2.5 microlitre), DNA Taq polymerase 5 U/microliter (0.25 microlitre), dNTPs 10 mM (0.5 microlitre), MgCl² 50 mM (1 microlitre), cDNA (2 microlitre), forward and reverse specific primers 10 picolitre (each one 0.5 microlitre), RNase-free water (11.75 microlitre) and SYBR Green 1 microlitre in final volume 20 microlitre. The PCR Thermocycler machine program was involved an initial denaturation at 94°C for 5 minutes, a denaturation at 94°C for 30 seconds, a primer annealing for 45 seconds (the temperatures have been shown in Table 2), an extension at 72°C for 45 seconds, and a final extension at 72°C for 5 minutes. The denaturation through extension step was repeated for 30-35 cycles. Fold changes of PREX2 gene’s expression in case and control groups were determined using the comparative real-time RT-PCR method and ΔΔCt formula^27-29.

TABLE 2
Forward and reverse specific primers PREX2.

Specific primers	Sequence (5’->3’)	Anealing (°C)	product length (bp)	Ref
PREX2	F: CACCCCGAACCTAATGCTCA	59	191	this study
	R: TCTGTGTTCTTCCGTCCTCC
GAPDH	F: GAAGGTGAAGGTCGGAGTCAAC	59	71	this study
	F: CAGAGTTAAAAGCAGCCCTGGT

Statistics

First, the relationship between patients’ qualitative demogra­phic variables was examined by chi-square tests, including Fisher’s exact²⁶. To evaluate statistical relationships between H. pylori virulence genes cDNA and the PREX2 gene expression, the Pearson and Spearman tests were used to measure normal and abnormal distributions of the PREX2 gene ΔΔCt, respectively²⁶. The statistical relationships between H. pylori infection and patients groups were evaluated using Mann-Whitney and Kruskal-Wallis tests. Similarly, the statistical relationship between PREX2 gene expression and H. pylori virulence genes subgroups were investigated²⁶.

RESULTS

This study’s results included statistically significant correlations related to demographics and gene expression in patients’ cells. Concerning patients’ demographics, gender and aging were associated with the incidence of gastric cancer. Table 3 shows a significant relationship between gastric cancer incidence among men in the Kurdistan province (P=0.024). As expected, the incidence of gastric cancer increased with age, so that the highest incidence of gastric cancer was in the age group of 76 to 85 years and the lowest incidence was in the age group of 18 to 30 years (P=0.000). In our study, no statistically significant relationship was observed between clinical outcomes and H. pylori infections (P=0.513). Our results showed no significant correlations between H. pylori infection and patients’ demographic data (Table 4).

TABLE 3
Demographic characteristics of patients and correlation of demographic variables.

	Gastritis	Gastric cancer	Total	P-value
H. pylori infection (positive/negative)	23/27	21/32	44/59	0.513
Sex (male/female)	24/26	37/16	50/53	0.024
Age group (18-30/31-45/46-60/61-75/76-80)	10/18/17/5/0	0/1/14/29/9	10/19/31/34/9	0.000

TABLE 4
Demographic characteristics of patients with H. pylori infection.

H. pylori infection (n: 103)	Sex (n)		Age group (n)
	Male	Female	18-30	31-45	46-60	61-75	76-85
H. pylori infection (positive)	28	16	2	11	14	16	1
H. pylori infection (negative)	33	26	8	8	17	18	8
Total	61	42	10	19	31	44	9

Table 5 shows the correlations between PREX2 gene expression and demographic data of patients. PREX2 gene expression showed a statistically significant difference between men and women (P=0.036). Also, the expression of the PREX2 gene in gastric antral epithelial cells of patients with H. pylori infection was twice as high as cells without H.pylori infection (P=0.016). The Kruskal-Wallis statistical test results in Table 6 show no statistical relationship between H. pylori virulence genes cDNA subtypes with PREX2 gene expression in gastric antral epithelial cells (P>0.05). The results of H. pylori genotypes showed an increase in PREX2 gene expression in gastric antral epithelial cells of individuals infected with vacA s1m1 and sabB H. pylori genotypes infection (Table 7).

TABLE 5
Correlation of PREX2 gene expression in gastric antral epithelial cells of gastritis and gastric cancer patients with patients’ demographic characteristics.

	Sex	Age group	Disease	H. pylori infection	Gastric cancer area	Tumor grade
PREX2 correlation	0.207	-0.049	-.0.104	-0.239	-0.002	0.202
P-value	0.036	0.620	0.269	0.016	0.991	0.146

TABLE 6
Correlation between PREX2 gene expression in gastric antral epithelial cells of gastritis and gastric cancer patients with H. pylori virulence genes using Spearman test.

	vacA s1m1/s1m2	cagA	cagA-EPEAYC	cagT	cagY	cagE	sabA/B	babA2/B	hopQI/II	alpA/B	oipA	iceA1/2
PREX2 correlation	0.378	-0.096	-0.152	-0.154	-0.199	-0.153	-0.477	-0.147	0.065	0.133	0.043	0.027
P-value	0.013	0.533	0.336	0.318	0.196	0.321	0.015	0.341	0.675	0.390	0.784	0.862

TABLE 7
Analysis of the relationship between sex, H. pylori infection, expression of vacA and sab genes of H. pylori variables with the expression of PREX2 gene in gastric antral epithelial cells of gastritis and gastric cancer patients with and without H. pylori infection using Mann-Wittny test. Gene expression changes in different subtypes were calculated using the ΔΔCt formula.

		N	Mean rank	Z	P-value	Mean ΔCt prex2	Fold change
Sex	Male	61	46.89	-2.094	0.036	8.7078	1.39
	Female	42	59.43			9.1843
H. pylori infection	Positive	44	43.76	-2.417	0.016	8.3275	2.00
	Negative	59	58.14			9.3307
vacA	s1m1	19	17.00	-2.477	0.013	7.5536	2.57
	s2m2	25	26.68			8.9157
SabA/B	Negative	12	15.17	-2.339	0.000	9.1438	5.52
	sabB	11	8.55	-	-	6.6775	-
	sabA	17	17.53	-	-	7.2796	-
	sabB	11	9.82	-2.423	0.007	6.6775	3.64

DISCUSSION

The results of the present study show a significant relationship between gastric cancer and gender and age group. In previous studies, the prevalence of this kind of cancer was higher in men^2,30. The results of a review study by Forman et al. showed that the cases of gastric cancer in the age group of 60-80 years, and men were twice as high as women¹. Although H. pylori is the main cause of gastric cancer and gastritis, the present study results showed no significant relationship between gastric cancer and gastritis with active H. pylori infection.

Based on previous studies’ results, increased expression of the PREX2 gene has an essential role in cancer and can be a biomarker in diagnosis and prognosis trends^20-24. Although our results showed that the expression of the PREX2 gene is increased in patients with grade 2 gastric cancer, there was no statistically significant relationship between tumor grade and expression of the PREX2 gene (data has not shown). Prex2 plays a vital role in regulating Wnt/β-catenin signaling in GC cells so that inhibition of Prex2 inhibits Wnt/β-catenin signaling in gastric cancer^21,22. In the current study, the relationship between PREX2 gene expression and age and sex of patients was investigated, but no significant relationship was observed. However, the expression of the PREX2 gene in people with gastritis and H. pylori infection is 2.38 times higher than in people with gastritis without H. pylori infection, that is supporting result to relevant previous studies on bacterium’s role in cell cycle interference, apoptosis, and gastric epithelial cell proliferation. On the other hand, increasing of the an increasing of PREX2 gene expression by 2.27 times in cancer samples with H. pylori infection compared to cancer samples without H. pylori infection can support the role of H. pylori infection in increasing of the PREX2 gene expression.

H. pylori infection increases the expression of PRDX2 by increasing NF-κB activity³¹. The study by Wang et al. shows that PRDX2 protects DNA damage and cell death against H. pylori oxidative stress and promotes gastric cancer³¹. A study by He et al. in 2016 showed that the PREX2 gene upregulation leads to the proliferation and migration of hepatocellular carcinoma cells via PTEN-AKT signaling and the PREX2 gene had increased in transcriptional and protein levels compared to expected²². A study by Li et al. in 2017 showed that the function of the PREX2 gene in hepatocellular carcinoma is high in 54.9% of carcinoma specimens, and Its mRNA level was high in tumor tissues and adjacent tumors²³. A study by Yang et al. in 2016 on examining the PREX2 gene’s characterization showed the proliferation, invasion, and cell migration in pancreatic cancer controlled by the PI3K signal pathway²⁰. Their study showed that repeated expression levels of PREX2 in cancer patients showed a sharp increase compared to normal tissues²⁰. Berger et al. also reported recurrent mutagens of the PREX2 gene in a 2012 study of squamous cell carcinoma genome sequencing¹⁹. They showed that the expression of various mutagens derived from the PREX2 gene facilitated cancerous tumors’ formation and involved the progression and severity of cancer and the proliferation of associated cells¹⁹.

H. pylori active infection causes inflammation, which is a early stage the tumor begins^32,5,7. H. pylori activate multiple cellular pathways in epithelial cells including Gsk3B, PI3K/AKT, NF_kB, MAPK, and Wnt/B_Catenin, which produce inflammatory cytokines, alter cell proliferation, differentiation, and cell apoptosis, which eventually leads to cellular apoptosis. Become cancerous⁷.

According to our study results, the cDNA of Helicobacter pylori vacA and sabB genes concludes the expression of the PREX2 gene in gastric antral epithelial cells. The previous studies concluded that the intensity of vacA and cagA genes’ expression in H. pylori was consistent with gastritis severity in patients^6,10.

Various studies have shown that sabB gene concludes more expression in inflamed tissues than in healthy tissues and will cause pathogenesis^13,15. On the other hand, the sabB gene’s off-status is associated with duodenal ulcers but is not associated with gastric ulcers, and SabB is less common in cancers and lymphomas¹³. During H. pylori infection, the amount of Sab glycoprotein is strongly associated with the extent of tissue damage, which is consistent with our study’s results¹³. Jonge and et al. in 2004 have reported a significant relationship between gastritis and duodenal ulcer with SabB protein expression; an odds ratio of less than one with the significant predictive value for duodenal ulcer¹⁵. In contrast, SabA status is associated with intestinal metaplasia and gastric cancer but is negatively associated with duodenal ulcers¹⁴. According to previous studies, it can be concluded that the expression of the sabB gene in the stomach of patients with gastritis and gastric cancer infected with H. pylori infection increases the expression of the PREX2 gene of gastric epithelial cells, which is consistent with the results of our studies^13,15.

In conclusion, H. pylori increases tumorigenesis in gastric epithelial cells through increasing PREX2 gene expression.

ACKNOWLEDGMENTS

This study results from Mrs. Sanaz Ahmadi (MSc Medical Microbiology) and Doctor Manouchehr Ahmadi Hedayati (Ph.D. of Medical Bacteriology) thesis. This study was supported and funded by the Kurdistan University of medical sciences by code number IR.MUK.REC.1397/196. The authors thank Delniya Khani (MSc Medical Microbiology), Doctor Farshad Sheikhesmaeili (Gastroenterologist), Doctor Bahram Nikkhoo (Pathologist), Doctor Bijan Nouri (Biostatitis), and Doctor Roghayeh Ghadyani (Internal Medicine) for supporting of sampling. The authors would like to express their deepest gratitude to all participants who contributed during the meeting to the development of this consensus: Dr. Manouchehr Ahmadi Hedayati, Miss. Sanaz Ahmadi, Mr. Karo Servatyari, Dr. Farshad Sheikhesmaeili.

REFERENCES

• ¹
  Forman D, Burley VJ. Gastric cancer: global pattern of the disease and an overview of environmental risk factors. Best Pract Res Clin Gastroenterol. 2006;20:633-49. DOI: 10.1016/j.bpg.2006.04.008.
  » https://doi.org/10.1016/j.bpg.2006.04.008
• ²
  Hedayati MA, Khani D. Relationship of social risk factors and Helicobacter pylori infection with pathological characteristics of Gastric carcinoma. Iran J Med Microbiol. 20;14:43-30. DOI: 10.30699/ijmm.14.1.43.
  » https://doi.org/10.30699/ijmm.14.1.43
• ³
  Wroblewski LE, Peek RM Jr, Wilson KT. Helicobacter pylori and gastric cancer: factors that modulate disease risk. Clin Microbiol Rev. 2010;23:713-739. DOI:10.1128/CMR.00011-10.
  » https://doi.org/10.1128/CMR.00011-10
• ⁴
  Chmiela M, Karwowska Z, Gonciarz W, Allushi B, Stączek P. Host pathogen interactions in Helicobacter pylori related gastric cancer. World J Gastroenterol. 2017;23:1521-40. DOI: 10.3748/wjg.v23.i9.1521. PMID: 28321154; PMCID: PMC5340805.
  » https://doi.org/10.3748/wjg.v23.i9.1521
• ⁵
  Kalali B, Mejias-Luque R, Javaheri A, Gerhard M. H. pylori virulence factors: influence on immune system and pathology. Mediators Inflamm. 2014;2014:426309.
• ⁶
  Jones KR, Whitmire JM, Merrell DS. A Tale of Two Toxins: Helicobacter Pylori CagA and VacA Modulate Host Pathways that Impact Disease. Front Microbiol. 2010;1:115.
• ⁷
  Sue S, Shibata W, Maeda S. Helicobacter pylori-Induced Signaling Pathways Contribute to Intestinal Metaplasia and Gastric Carcinogenesis. Biomed Res Int. 2015;2015:737621.
• ⁸
  Bridge DR, Merrell DS. Polymorphism in the Helicobacter pylori CagA and VacA toxins and disease. Gut Microbes. 2013;4:101-117. DOI:10.4161/gmic.23797.
  » https://doi.org/10.4161/gmic.23797
• ⁹
  Blaser MJ, Atherton JC. Helicobacter pylori persistence: biology and disease. J Clin Invest. 2004;113:321-33. DOI:10.1172/JCI20925.
  » https://doi.org/10.1172/JCI20925
• ¹⁰
  Abdullah M, Greenfield LK, Bronte-Tinkew D, Capurro MI, Rizzuti D, Jones NL. VacA promotes CagA accumulation in gastric epithelial cells during Helicobacter pylori infection. Sci Rep. 2019;9:38. DOI:10.1038/s41598-018-37095-4.
  » https://doi.org/10.1038/s41598-018-37095-4
• ¹¹
  Oleastro M, Ménard A. The Role of Helicobacter pylori Outer Membrane Proteins in Adherence and Pathogenesis. Biology. 2013;2:1110-34. DOI: 10.3390/biology2031110.
  » https://doi.org/10.3390/biology2031110
• ¹²
  Matsuo Y, Kido Y, Yamaoka Y. H. pylori outer membrane protein-related pathogenesis. Toxins. 2017;9:101. DOI: 10.3390/toxins9030101.
  » https://doi.org/10.3390/toxins9030101
• ¹³
  Magalhaes A, Marcos-Pinto R, Nairn AV, Dela Rosa M, Ferreira RM, Junqueira-Neto S, et al. Helicobacter pylori chronic infection and mucosal inflammation switches the human gastric glycosylation pathways. Biochim Biophys Acta. 2015;1852:1928-39. DOI: 10.1016/j.bbadis.2015.07.001.
  » https://doi.org/10.1016/j.bbadis.2015.07.001
• ¹⁴
  Yamaoka Y. Increasing evidence of the role of Helicobacter pylori SabA in the pathogenesis of gastroduodenal disease. J Infect Dev Ctries. 2008;2:174-181. DOI:10.3855/jidc.259.
  » https://doi.org/10.3855/jidc.259
• ¹⁵
  De Jonge R, Pot RG, Loffeld RJ, Van Vliet AH, Kuipers EJ, Kusters JG. The functional status of the H. pylori sabB adhesin gene as a putative marker for disease outcome. Helicobacter. 2004;9:158-64. DOI: 10.1111/j.1083-4389.2004.00213.x.
  » https://doi.org/10.1111/j.1083-4389.2004.00213.x
• ¹⁶
  Tran CT, Garcia M, Garnier M, Burucoa C, Bodet C. Inflammatory signaling pathways induced by Helicobacter pylori in primary human gastric epithelial cells. Innate Immun. 2017;23:165-174. DOI: 10.1177/1753425916681077.
  » https://doi.org/10.1177/1753425916681077
• ¹⁷
  Sgouras DN, Trang TTH, Yamaoka Y. Pathogenesis of Helicobacter pylori infection. Helicobacter. 2015;20 (Suppl 1):8-16. DOI: 10.1111/hel.12251.
  » https://doi.org/10.1111/hel.12251
• ¹⁸
  Zhang XY, Zhang PY, Aboul-Soud MA. From inflammation to gastric cancer: Role of Helicobacter pylori. Oncol Lett. 2017;13:543-8. DOI:10.3892/ol.2016.5506.
  » https://doi.org/10.3892/ol.2016.5506
• ¹⁹
  Berger MF, Hodis E, Heffernan TP, Deribe YL, Lawrence MS, Protopopov A, et al. Melanoma genome sequencing reveals frequent PREX2 mutations. Nature. 2012;485:502-6. DOI: 10.1038/nature11071.
  » https://doi.org/10.1038/nature11071
• ²⁰
  Yang J, Gong X, Ouyang L, He W, Xiao R, Tan L. PREX2 promotes the proliferation, invasion and migration of pancreatic cancer cells by modulating the PI3K signaling pathway. Oncol Lett . 2016;12:1139-43. DOI:10.3892/ol.2016.4688
  » https://doi.org/10.3892/ol.2016.4688
• ²¹
  Lee TH, Jin JO, Yu KJ, Kim HS, Lee PC. Inhibition of peroxiredoxin 2 suppresses Wnt/β-catenin signaling in gastric cancer. Biochem Biophys Res Commun. 2019;512:250-5. DOI: 10.1016/j.bbrc.2019.03.039
  » https://doi.org/10.1016/j.bbrc.2019.03.039
• ²²
  He S, Lin J, Yu S, Sun S. Upregulation of PREX2 promotes the proliferation and migration of hepatocellular carcinoma cells via PTEN-AKT signaling. Oncol Lett . 2016;11:2223-28. DOI:10.3892/ol.2016.4164.
  » https://doi.org/10.3892/ol.2016.4164
• ²³
  Li CH, Yen CH, Chen YF, Lee KJ, Fang CC, Zhang X, et al. Characterization of the GNMT-HectH9-PREX2 tripartite relationship in the pathogenesis of hepatocellular carcinoma. Int J Cancer. 2017;140:2284-97. DOI: 10.1002/ijc.30652.
  » https://doi.org/10.1002/ijc.30652
• ²⁴
  Niu L, Liu A, Xu W, Yang L, Zhu W, Gu Y. Downregulation of peroxiredoxin II suppresses the proliferation and metastasis of gastric cancer cells. Oncology letters. 2018;16:4551-60.
• ²⁵
  Charan J, Biswas T. How to calculate sample size for different study designs in medical research?. Indian J Psychol Med. 2013;35:121-6. DOI:10.4103/0253-7176.116232.
  » https://doi.org/10.4103/0253-7176.116232
• ²⁶
  Nayak BK, Hazra A. How to choose the right statistical test?. Indian J Ophthalmol. 2011;59:85-6. DOI:10.4103/0301-4738.77005.
  » https://doi.org/10.4103/0301-4738.77005
• ²⁷
  Kralik P, Ricchi M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front Microbiol . 2017;8:108. DOI:10.3389/fmicb.2017.00108.
  » https://doi.org/10.3389/fmicb.2017.00108
• ²⁸
  Deepak S, Kottapalli K, Rakwal R, Oros G, Rangappa K, Iwahashi H, et al. Real-Time PCR: Revolutionizing Detection and Expression Analysis of Genes. Curr Genomics. 2007;8:234-51. DOI:10.2174/138920207781386960.
  » https://doi.org/10.2174/138920207781386960
• ²⁹
  Schefe JH, Lehmann KE, Buschmann IR, Unger T, Funke-Kaiser H. Quantitative real-time RT-PCR data analysis: current concepts and the novel “gene expression’s CT difference” formula. J Mol Med (Berl). 2006;84:901-10. DOI: 10.1007/s00109-006-0097-6.
  » https://doi.org/10.1007/s00109-006-0097-6
• ³⁰
  Rawla P, Barsouk A. Epidemiology of gastric cancer: global trends, risk factors and prevention. Prz Gastroenterol. 2019;14:26-38. DOI:10.5114/pg.2018.80001.
  » https://doi.org/10.5114/pg.2018.80001
• ³¹
  Wang S, Chen Z, Zhu S, Lu H, Peng D, Soutto M, et al. PRDX2 protects against oxidative stress induced by H. pylori and promotes resistance to cisplatin in gastric cancer. Redox biol. 2020;28:101319.
• ³²
  Silva-García O, Valdez-Alarcón JJ, Baizabal-Aguirre VM. Wnt/β-Catenin Signa­ling as a Molecular Target by Pathogenic Bacteria. Front Immunol. 2019;10:2135.

• Disclosure of funding: no funding received

Publication Dates

• Publication in this collection
  22 Oct 2021
• Date of issue
  Jul-Sep 2021

History

• Received
  29 Jan 2021
• Accepted
  03 Mar 2021