Accessibility / Report Error

T300A GENETIC POLYMORPHISM: a susceptibility factor for Crohn’s disease?

Polimorfismo genético T300A: fator de susceptibilidade para doença de Crohn?

Abstracts

Context

Crohn’s disease is characterized by a chronic and debilitating inflammatory disorder of the gastrointestinal tract. Several factors may contribute to its development. From extensive studies of the human genome, the polymorphism T300A of the gene ATG16L1 (autophagy-related 16-like 1) has been related to increased risk of developing this disease.

Objectives

Analyze the role of polymorphism T300A (rs2241880) in patients with Crohn’s disease.

Methods

238 samples from (control group) and 106 samples from patients with Crohn’s disease recruited at five Southern Brazilian reference centers were evaluated. The genotyping consisted of the amplification via Polymerase Chain Reaction of the genomic segment encompassing T300A, followed by Restriction Fragment Length Polymorphism analysis. The amplicons and fragments were separated by agarose gel electrophoresis and confirmed under ultraviolet light.

Results

The genotype AG was more prevalent among patients and controls (50% vs 44.8%), followed by genotypes AA (26.4% vs 35.1%) and GG (23.6% vs 20.1%). The frequency of the allele G of the polymorphism T300A was higher in the group of patients with Crohn’s disease (48.6%) than in controls (42.4%), although not reaching statistical significance.

Conclusions

It was not possible to confirm the increased susceptibility on development of Crohn’s disease conferred by polymorphism T300A.

Crohn’s disease; Carrier proteins, genetics; Single-nucleotide polymorphism


Contexto

A doença de Crohn caracteriza-se por uma desordem inflamatória, crônica e debilitante do trato gastrointestinal. Diversos fatores contribuem para seu desenvolvimento. A partir da realização de estudos amplos do genoma, o polimorfismo T300A do gene ATG16L1 (autophagy-related 16-like 1) tem sido relacionado com aumento de susceptibilidade ao desenvolvimento desta doença.

Objetivos

Analisar a incidência do polimorfismo T300A (rs2241880) em pacientes com doença de Crohn.

Métodos

Foram analisadas 238 amostras de doadores de sangue (grupo controle) e 106 amostras de pacientes com doença de Crohn, procedentes de cinco centros. A genotipagem consistiu em amplificação do segmento gênico T300A, via reação em cadeia da polimerase, seguidos da análise de polimorfismo de comprimentos dos fragmentos de restrição. Os amplicons e fragmentos foram separados via eletroforese em gel de agarose e visualizados sob luz ultravioleta.

Resultados

O genótipo AG foi mais prevalente entre os pacientes e controles (50% vs 44,8%), seguido dos genótipos AA (26,4% vs 35,1%) e GG (23,6% vs 20,1%). A freqüência do alelo G do polimorfismo T300A foi maior no grupo de pacientes com doença de Crohn (48,6%) do que nos controles (42,4%), embora sem significância estatística.

Conclusões

Não foi possível confirmar o aumento de susceptibilidade à doença de Crohn conferido pelo polimorfismo T300A.

Doença de Crohn; Proteínas de transporte, genética; Polimorfismo de nucleotídeo único


INTRODUCTION

Crohn’s disease (CD) is characterized by a chronic and debilitating inflammatory disorder of the gastrointestinal tract showing different clinical presentations. It may occur anywhere in the digestive tract, although most commonly involving the terminal ileum, presenting discontinuous and transmural ulcerations often associated with stenosis and fistulas(44. Crohn BB, Ginzburg L, Oppenheimer GD. Regional Ileitis: A Pathologic and Clinical Entity. JAMA. 1932;99:1323-9., 77. Fowler EV, Doecke J, Simms LA, Zhao ZZ, Webb PM, Hayward NK, Whiteman C, Florin TH, Montgomery GW, Cavanaugh JA, Radford-Smith GH. ATG16L1 T300A shows strong associations with disease subgroups in a large Australian IBD population: further support for significant disease heterogeneity. AJG. 2008;103:2519-26., 1010. Koltum WA. Inflammatory Bowel Disease: Diagnosis and Evaluation. The ASCRS Textbook of Colon and Rectal Surgery. 2007:544.).

Despite its increasing incidence and prevalence, the understanding of the etiopathogenic mechanisms remains a major challenge. It is known, however, that a variety of factors contribute to its development, such as environmental influences, intestinal microbiota, aberrant immune responses and the individual genetic predisposition(22. Brasil. Portal da Saúde. Doença de Crohn. [cited 01 Mai 2013]. Available from: http://portal.saude.gov.br/saude/visualizar_texto.cfm?idtxt=23529., 33. Cheng JF. T300A polymorphism of ATG16L1 and susceptibility to inflammatory bowel diseases: A meta-analysis. WJG. 2010;16:1258., 1515. Scaldaferri F, Fiocchi C. Inflammatory bowel disease: progress and current concepts of etiopathogenesis. J Dig Dis. 2007;8(4):171-8., 1616. Schirbel A, Fiocchi C. Inflammatory bowel disease: Established and evolving considerations on its etiopathogenesis and therapy. J dig dis. 2010:11:266-76., 1818. Tsianos EV, Katsanos KH, Tsianos VE. Role of genetics in the diagnosis and prognosis of Crohn’s disease. WJG. 2012;18:105-18.).

From extensive studies of the human genome (Genome-wide Association Studies; GWAS), a gene of apparent relevance to CD was identified. Named as ATG16L1 (autophagy-related 16-like 1), its product plays an important role in the innate immune response and in the resistance to intracellular pathogens(99. Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, et al. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet. 2007;39:207-11., 1313. Pinho MA. Biologia molecular das doenças inflamatórias intestinais. Journal of Coloproctology. 2008;28(1)., 1414. Plantinga TS, Crisan TO, Oosting M, van de Veerdonk FL, de Jong DJ, Philpott DJ. Crohn’s disease-associated ATG16L1 polymorphism modulates pro-inflammatory cytokine responses selectively upon activation of NOD2. Gut. 2011;60:1229-35.).

Several polymorphisms have been identified in the gene ATG16L1, highlighting the single-nucleotide polymorphism (SNP) T300A (rs2241880), which appears to confer an increased risk of developing inflammatory bowel diseases (IBD)(33. Cheng JF. T300A polymorphism of ATG16L1 and susceptibility to inflammatory bowel diseases: A meta-analysis. WJG. 2010;16:1258., 55. Csöngei V. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. WJG. 2010;16:176., 88. Gazouli M. NOD2 / CARD15 , ATG16L1 and IL23R gene polymorphisms and childhood-onset of Crohn’s disease. WJG. 2010;16:1753., 1717. Schmid D, Dengjel J, Schoor O, Stevanovic S, Münz C. Autophagy in innate and adaptive immunity against intracellular pathogens. Journal of molecular medicine (Berlin, Germany). 2006;84:194-202., 1919. Zhang H-F, Qiu L-X, Chen Y, Zhu W-L, Mao C, Zhu L-G, et al. ATG16L1 T300A polymorphism and Crohn’s disease susceptibility: evidence from 13,022 cases and 17,532 controls. Hum Genet. 2009;125:627-31.).

Considering the limited data available regarding the Brazilian population, the aim of this study was to analyze the role of the SNP T300A of the gene ATG16L1 as a possible predisposing factor for the occurrence of CD.

METHODS

Patients

Single blood samples from 106 patients with confirmed diagnosis of CD, collected between 2011 and 2012, were evaluated.

Patients were recruited in five reference centers for the treatment of the disease, namely, Inflammatory Bowel Disease Clinic of the Hospital São José, Joinville/SC (n = 40), Inflammatory Bowel Disease Clinic of the University of Vale do Itajaí - Univali, Itajaí/SC (n = 21); Coloproctology Service of the University Hospital Cajurú (SeCoHUC), Pontifical Catholic University of Paraná - PUCPR, Curitiba/PR (n = 32), Inflammatory Bowel Disease Clinic of the Hospital of the Federal University of Paraná - HC/UFPR, Curitiba/PR (n = 9) and Inflammatory Bowel Disease Clinic of the Hospital Santa Isabel, Blumenau/SC (n = 4).

The inclusion of these patients occurred in a consecutive way, regardless of their age, gender, skin color, general health status and social stratum.

Controls

The blood samples from 238 blood donation volunteers of the Regional Blood Bank (HEMOSC) were collected in the same period of time. Donors with consanguineous kinship were excluded. The HEMOSC is located in the city of Joinville/SC, southern of Brazil, approximately 100 km away from the other four patients recruitment centres; thus it is not expected relevant ethnic/racial differences between patients and controls.

DNA Extraction

The peripheral blood sample of patients with CD was obtained by finger puncture, followed by the collection and storage on FTA Elute Micro Card® (Whatman, Kent, UK). The genomic DNA extraction was performed according to the card manufacturer´s specifications. The extraction and purification procedures of the genomic DNA of the samples belonging to the control group were carried out using the Qiamp DNA Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions.

Genotyping of SNP T300A (rs2241880)

The methodology employed for SNP T300A genotyping was based on the study of Csongei et al.(55. Csöngei V. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. WJG. 2010;16:176.), consisting of the partial amplification of the segment containing rs2241880 via PCR (Polymerase Chain Reaction), followed by allelic discrimination via RFLP (Restriction Fragment Lenght Polymorphism). Each PCR reaction (50 μL) received 1 μL dNTP’s (10 mM), 0.2 μL Platinum® Taq DNA Polymerase (5 U/μL; Invitrogen, São Paulo, Brazil), 5 μL reaction buffer (10x), 1.5 !!!!!!μL magnesium chloride (50 mM), 1 μL of each primer (10 pmol/reaction; Forward - CTCTGTCACCATATCAAGCGTGG, Reverse - TCTAGAAGGACAGGCTATCAACAGATG; Eurofins MWG Operon, Huntsville, USA) and 2 μL of DNA (50 to 500 ng). The amplifications were conducted under the following reaction conditions: initial denaturation at 94°C for 3 minutes followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing for 40 seconds at 55°C and extension at 72°C for 40 seconds completion with 72 °C extension for 7 minutes. The thermocycling was conducted in XP Thermal Cycler apparatus (BIOER technology Co, Tokyo, Japan).

After the PCR, amplicons were digested by endonuclease LweI (Fermentas, Burlington, USA) at 37°C during 1 hour, according to the manufacturer’s instructions. The fragments generated were separated by 2% agarose gel electrophoresis containing ethidium bromide, followed by exposure to ultraviolet light. The figure 1 illustrates the electrophoretic patterns corresponding to each genotype.

FIGURE 1.
Electrophoretic profiles corresponding to homozigous genotypes GG (1) and AA (2) and heterozygous genotype AG (3) of the SNP T300A of the gene ATG16L1. M: molecular size standard (100 bp ladder, Fermentas, Ontario, Canada), NC: negative control.

Statistical Analysis

Proportions were employed for the categorical variables, while averages and standard deviations were used for the continuous ones. The possible genotypic and allelic association with the susceptibility to CD was verified using the HDS software, based on 2x2 contingency tables, through Odds Ratio as indicator, adopting a confidence interval of 95% and considering significant the P values lesser than 0.05.

Ethics Statements

The patients were only included after elucidation of the aims of this work and their confirming of authorization via signature in Free and Informed Consent Form. The research was approved by the Institutional Review Board of the University of the Region of Joinville (Case No. 042/11), according to Brazilian ethical standards in research involving humans.

RESULTS

The group of patients was composed of 106 individuals, being 56 females and 50 males, with an average age of 41.4 (± 12.7) years old. The clinical characteristics are shown in Table 1. In the analysis of the distribution of genotype frequencies related to the SNP T300A we observed a higher frequency of the heterozygous genotype (50%) compared to the homozygous genotypes AA (26.4%) and GG (23.6%). Concerning the allele frequencies, there was a slight predominance of the allele A (51.4%) (Table 2).

TABLE 1.
Clinical characteristics of the patients with Crohn’s disease
TABLE 2.
Genotypic and allelic frequencies and associative analysis

The control group totalized 238 volunteers with an average age of 32 (± 10.6) years old and was composed mainly by males (67.7%). According to the results of genotyping, a higher frequency of the heterozygous genotype (44.8%) was observed when compared to homozygote genotypes AA (35.1%) and GG (20.1%). Regarding the allele frequencies, there was also a predominance of the allele A among controls (57.3%), without significant differences between groups.

DISCUSSION

The major technological breakthrough occurred over the past few years, especially in the last decade, has enabled the development of analytical techniques of molecular biology of tissues and also brought a renewal of hope on the possibility of answers in the field of IBD(1313. Pinho MA. Biologia molecular das doenças inflamatórias intestinais. Journal of Coloproctology. 2008;28(1).).

Although groups of family members have been described in CD, genes considered as susceptibility factors were not pointed until 2001, when NOD2/CARD15(1111. Kucharzik T, Maaser C, Lügering A, Kagnoff M, Mayer L, Targan S. Recent understanding of IBD pathogenesis: implications for future therapies. Inflamm Bowel Dis. 2006;12:1068-83.) was identified. The genetics of IBD, and especially of the CD, achieved a major breakthrough with the publication of the results of the first GWAS directed to such diseases(66. Duerr RH. Genome-wide association studies herald a new era of rapid discoveries in inflammatory bowel disease research. Gastroenterology. 2007;132:2045-9.). From this pioneer study, several new susceptibility loci were identified, among these the gene ATG16L1, which was described by Hampe et al.(99. Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, et al. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet. 2007;39:207-11.). Several polymorphisms and somatic alterations have been identified in the gene ATG16L1, highlighting the SNP T300A (rs2241880), whose allele G appears to confer a higher risk for the development of IBD(33. Cheng JF. T300A polymorphism of ATG16L1 and susceptibility to inflammatory bowel diseases: A meta-analysis. WJG. 2010;16:1258., 55. Csöngei V. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. WJG. 2010;16:176., 88. Gazouli M. NOD2 / CARD15 , ATG16L1 and IL23R gene polymorphisms and childhood-onset of Crohn’s disease. WJG. 2010;16:1753., 1717. Schmid D, Dengjel J, Schoor O, Stevanovic S, Münz C. Autophagy in innate and adaptive immunity against intracellular pathogens. Journal of molecular medicine (Berlin, Germany). 2006;84:194-202., 1919. Zhang H-F, Qiu L-X, Chen Y, Zhu W-L, Mao C, Zhu L-G, et al. ATG16L1 T300A polymorphism and Crohn’s disease susceptibility: evidence from 13,022 cases and 17,532 controls. Hum Genet. 2009;125:627-31.).

Zhang et al.(1919. Zhang H-F, Qiu L-X, Chen Y, Zhu W-L, Mao C, Zhu L-G, et al. ATG16L1 T300A polymorphism and Crohn’s disease susceptibility: evidence from 13,022 cases and 17,532 controls. Hum Genet. 2009;125:627-31.) conducted an extensive meta-analysis aiming at understanding the role of the polymorphism T300A of the gene ATG16L1 as a susceptibility factor for CD involving 24 studies, totaling 13,022 cases and 17,532 controls. The authors found a positive association in Caucasians, but the same result was not possible to confirm in Asians, suggesting that this difference is possibly related to ethnic variations. This hypothesis was reinforced by the observation that the frequency of the allele G showed differences between these populations. Furthermore, none relevant clinical differences were found in association with the location of patients.

In 2010, Cheng et al.(33. Cheng JF. T300A polymorphism of ATG16L1 and susceptibility to inflammatory bowel diseases: A meta-analysis. WJG. 2010;16:1258.) published another meta-analysis including Asian, American, European and Oceanian populations. In this meta-analysis, the authors confirmed the positive association between the SNP T300A and susceptibility to CD. Two other studies, also published in 2010, corroborated this result(55. Csöngei V. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. WJG. 2010;16:176., 88. Gazouli M. NOD2 / CARD15 , ATG16L1 and IL23R gene polymorphisms and childhood-onset of Crohn’s disease. WJG. 2010;16:1753.).

The data on the variants distribution of the SNP T300A of the gene ATG16L1 in the Brazilian population are scarce. The only study known, published in 2008, based on the analysis of 180 patients with CD, shows the following genotypic frequencies: AA - 22.2%, AG - 54.2% and GG - 25.5%(11. Baptista ML, Amarante H, Picheth G, Sdepanian VL, Peterson N, Babasukumar U. CARD15 and IL23R influences Crohn’s disease susceptibility but not disease phenotype in a Brazilian population. Inflamm Bowel Dis. 2008;14:674-9.). These data are compatible with the results obtained in this study, which cannot confirm a significant association between the polymorphism T300A and CD. No statistical differences were found when comparing cases and controls.

In comparison with other published studies (Table 3), we observed compatibility regarding the most frequent genotype: AG(11. Baptista ML, Amarante H, Picheth G, Sdepanian VL, Peterson N, Babasukumar U. CARD15 and IL23R influences Crohn’s disease susceptibility but not disease phenotype in a Brazilian population. Inflamm Bowel Dis. 2008;14:674-9., 55. Csöngei V. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. WJG. 2010;16:176., 77. Fowler EV, Doecke J, Simms LA, Zhao ZZ, Webb PM, Hayward NK, Whiteman C, Florin TH, Montgomery GW, Cavanaugh JA, Radford-Smith GH. ATG16L1 T300A shows strong associations with disease subgroups in a large Australian IBD population: further support for significant disease heterogeneity. AJG. 2008;103:2519-26., 1212. Marquez A, Nunes C, Martinez A, Mendonza JL, Taxonera C, Fernandez-Arquero M,et al. Role of ATG16L1 Thr300Ala Polymorphism in Inflammatory Bowel Disease: A Study in the Spanish Population and a Mata-analysis. Inflamm Bowel Dis. 2009;15:1697-704.). However, there is divergence among the higher frequency of homozygous genotypes in different populations, as mentioned by Zhang et al.(1919. Zhang H-F, Qiu L-X, Chen Y, Zhu W-L, Mao C, Zhu L-G, et al. ATG16L1 T300A polymorphism and Crohn’s disease susceptibility: evidence from 13,022 cases and 17,532 controls. Hum Genet. 2009;125:627-31.).

TABLE 3.
Genotypic distribution of the polymorphism T300A observed in diferent populations with Crohn’s disease and controls

Our isolates results did not follow the global trend that shows increased susceptibility to CD in carriers of the genotype GG of rs2241880 in various populations(33. Cheng JF. T300A polymorphism of ATG16L1 and susceptibility to inflammatory bowel diseases: A meta-analysis. WJG. 2010;16:1258., 55. Csöngei V. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. WJG. 2010;16:176., 77. Fowler EV, Doecke J, Simms LA, Zhao ZZ, Webb PM, Hayward NK, Whiteman C, Florin TH, Montgomery GW, Cavanaugh JA, Radford-Smith GH. ATG16L1 T300A shows strong associations with disease subgroups in a large Australian IBD population: further support for significant disease heterogeneity. AJG. 2008;103:2519-26., 88. Gazouli M. NOD2 / CARD15 , ATG16L1 and IL23R gene polymorphisms and childhood-onset of Crohn’s disease. WJG. 2010;16:1753., 1212. Marquez A, Nunes C, Martinez A, Mendonza JL, Taxonera C, Fernandez-Arquero M,et al. Role of ATG16L1 Thr300Ala Polymorphism in Inflammatory Bowel Disease: A Study in the Spanish Population and a Mata-analysis. Inflamm Bowel Dis. 2009;15:1697-704., 1919. Zhang H-F, Qiu L-X, Chen Y, Zhu W-L, Mao C, Zhu L-G, et al. ATG16L1 T300A polymorphism and Crohn’s disease susceptibility: evidence from 13,022 cases and 17,532 controls. Hum Genet. 2009;125:627-31.). However, we decided to speculate what would be observed when adding the number of samples from Baptista et al.(11. Baptista ML, Amarante H, Picheth G, Sdepanian VL, Peterson N, Babasukumar U. CARD15 and IL23R influences Crohn’s disease susceptibility but not disease phenotype in a Brazilian population. Inflamm Bowel Dis. 2008;14:674-9.), also belonging to Southern individuals, with the numbers of the current study, which amounted 286 Brazilian patients with CD. Of the whole patients, 23.7% show homozygous genotype AA, 51.3% heterozygous AG and 24.8% homozygous GG. By applying the same statistical tools in this larger group in comparison with controls, the polymorphism T300A was significantly associated (P = 0.01, OR = 0.633 [0444-0900]) with CD (Table 4). This finding confirms that the size of our sample, when compared to other population studies, have directly influenced our results.

TABLE 4.
Genotypic and allelic frequencies and associative analysis considering the sample of Batista et al. (2008) added to the one of the current study

We emphasize that further investigations related to the SNP T300A of the gene ATG16L1 and to other genes possibly associated with susceptibility to CD must be conducted in the Brazilian population and thus contribute with additional data for the purpose of elucidating the natural history and pathophysiology of this disease.

Acknowledgements

The authors thank the medical colleagues for their contribution to this work, especially Harry Kleinubing Júnior, Paulo Gustavo kotze, Éverson Fernando Mallutta, Juliano Coelho Ludvig, Antônio Baldin Júnior, and Maria Gabriela Lazcano Alves Ferreira, who have contributed with data and samples.

REFERENCES

  • 1
    Baptista ML, Amarante H, Picheth G, Sdepanian VL, Peterson N, Babasukumar U. CARD15 and IL23R influences Crohn’s disease susceptibility but not disease phenotype in a Brazilian population. Inflamm Bowel Dis. 2008;14:674-9.
  • 2
    Brasil. Portal da Saúde. Doença de Crohn. [cited 01 Mai 2013]. Available from: http://portal.saude.gov.br/saude/visualizar_texto.cfm?idtxt=23529.
  • 3
    Cheng JF. T300A polymorphism of ATG16L1 and susceptibility to inflammatory bowel diseases: A meta-analysis. WJG. 2010;16:1258.
  • 4
    Crohn BB, Ginzburg L, Oppenheimer GD. Regional Ileitis: A Pathologic and Clinical Entity. JAMA. 1932;99:1323-9.
  • 5
    Csöngei V. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. WJG. 2010;16:176.
  • 6
    Duerr RH. Genome-wide association studies herald a new era of rapid discoveries in inflammatory bowel disease research. Gastroenterology. 2007;132:2045-9.
  • 7
    Fowler EV, Doecke J, Simms LA, Zhao ZZ, Webb PM, Hayward NK, Whiteman C, Florin TH, Montgomery GW, Cavanaugh JA, Radford-Smith GH. ATG16L1 T300A shows strong associations with disease subgroups in a large Australian IBD population: further support for significant disease heterogeneity. AJG. 2008;103:2519-26.
  • 8
    Gazouli M. NOD2 / CARD15 , ATG16L1 and IL23R gene polymorphisms and childhood-onset of Crohn’s disease. WJG. 2010;16:1753.
  • 9
    Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, et al. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet. 2007;39:207-11.
  • 10
    Koltum WA. Inflammatory Bowel Disease: Diagnosis and Evaluation. The ASCRS Textbook of Colon and Rectal Surgery. 2007:544.
  • 11
    Kucharzik T, Maaser C, Lügering A, Kagnoff M, Mayer L, Targan S. Recent understanding of IBD pathogenesis: implications for future therapies. Inflamm Bowel Dis. 2006;12:1068-83.
  • 12
    Marquez A, Nunes C, Martinez A, Mendonza JL, Taxonera C, Fernandez-Arquero M,et al. Role of ATG16L1 Thr300Ala Polymorphism in Inflammatory Bowel Disease: A Study in the Spanish Population and a Mata-analysis. Inflamm Bowel Dis. 2009;15:1697-704.
  • 13
    Pinho MA. Biologia molecular das doenças inflamatórias intestinais. Journal of Coloproctology. 2008;28(1).
  • 14
    Plantinga TS, Crisan TO, Oosting M, van de Veerdonk FL, de Jong DJ, Philpott DJ. Crohn’s disease-associated ATG16L1 polymorphism modulates pro-inflammatory cytokine responses selectively upon activation of NOD2. Gut. 2011;60:1229-35.
  • 15
    Scaldaferri F, Fiocchi C. Inflammatory bowel disease: progress and current concepts of etiopathogenesis. J Dig Dis. 2007;8(4):171-8.
  • 16
    Schirbel A, Fiocchi C. Inflammatory bowel disease: Established and evolving considerations on its etiopathogenesis and therapy. J dig dis. 2010:11:266-76.
  • 17
    Schmid D, Dengjel J, Schoor O, Stevanovic S, Münz C. Autophagy in innate and adaptive immunity against intracellular pathogens. Journal of molecular medicine (Berlin, Germany). 2006;84:194-202.
  • 18
    Tsianos EV, Katsanos KH, Tsianos VE. Role of genetics in the diagnosis and prognosis of Crohn’s disease. WJG. 2012;18:105-18.
  • 19
    Zhang H-F, Qiu L-X, Chen Y, Zhu W-L, Mao C, Zhu L-G, et al. ATG16L1 T300A polymorphism and Crohn’s disease susceptibility: evidence from 13,022 cases and 17,532 controls. Hum Genet. 2009;125:627-31.
  • Sources of Research Funding: Fundo de Apoio a Pesquisa - FAP / Univille
  • Research performed at: Laboratório de Biologia Molecular, Universidade da Região de Joinville - UNIVILLE - Joinville, Santa Catarina, Brasil.

Publication Dates

  • Publication in this collection
    Apr-Jun 2014

History

  • Received
    27 Oct 2013
  • Accepted
    5 Dec 2013
Instituto Brasileiro de Estudos e Pesquisas de Gastroenterologia e Outras Especialidades - IBEPEGE. Rua Dr. Seng, 320, 01331-020 São Paulo - SP Brasil, Tel./Fax: +55 11 3147-6227 - São Paulo - SP - Brazil
E-mail: secretariaarqgastr@hospitaligesp.com.br