Investigation of factors related to biofilm formation in Providencia stuartii

Abstract

Providencia stuartii is one of the Enterobacteriaceae species of medical importance commonly associated with urinary infections, which can also cause other ones, including uncommon ones, such as liver abscess and septic vasculitis. This bacterium stands out in the expression of intrinsic and acquired resistance to antimicrobials. Besides, it uses mechanisms such as biofilm for its persistence in biotic and abiotic environments. This study investigated the cellular hydrophobicity profile of clinical isolates of P. stuartii. It also analyzed genes related to the fimbrial adhesin in this species comparing with other reports described for other bacteria from Enterobacteriaceae family. The investigated isolates to form biofilm and had a practically hydrophilic cell surface profile. However, fimH and mrkD genes were not found in P. stuartii, unlike observed in other species of Enterobacteriaceae. These results show that P. stuartii has specificities regarding its potential for biofilm formation, which makes it difficult to destabilize the infectious process and increases the permanence of this pathogen in hospital units.

Key words
Enterobacteriaceae; fimH; mrkD; virulence

INTRODUCTION

Providencia is one of the genera that make up the Enterobacteriaceae family. The species P. stuartii being one of the most frequent and widely associated with urinary tract infections, especially in patients undergoing long periods of catheterization (Armbruster et al. 2014, Kurmasheva et al. 2018). As it is an opportunistic pathogen, this bacterium can cause other infections: septicemia (Aires et al. 2016), diarrhea (Shima et al. 2016), pneumonia (Abdallah & Balshi 2018), infections in burns and open wounds (Pirii et al. 2018, Libertucci et al. 2019), even those uncommon for this species, such as conjunctivitis (Crane et al. 2016), liver abscesso (Lin et al. 2017), rectal abscesso (Lee et al. 2017), and septic vasculitis (George et al. 2020).

Providencia stuartii corresponds to one of the β-lactamase-producing enterobacteria of the chromosomal AmpC type. Therefore, it has a natural resistance to most β-lactam antimicrobials, including penicillins, cephalosporins, and combinations with β-lactamase inhibitors lactamases (Magiorakos et al. 2012, Santiago et al. 2016). It is also intrinsically resistant to aminoglycosides (except amikacin) and antimicrobials of last therapeutic choice, such as tigecycline, colistin, and polymyxin B (CLSI 2018). Additionally, it can acquire resistance genes that encode different types of enzymes such as aminoglycoside-modifying enzymes (AMEs), β-lactamases of Extended Spectrum (ESBLs), and carbapenemases (Miró et al. 2013, Oikonomou et al. 2016, Mao et al. 2018, Molnár et al. 2019).

The pathogenicity of this species is further amplified by its ability to form biofilms (El-Khatib et al. 2017, 2018). The biofilm corresponds to a matrix composed mainly of exopolysaccharides (EPS), which allows the passage of nutrients through pores and channels. In most cases, there found bacteria living in communities or adhered to the surfaces of biotic or abiotic materials, such as human body tissues and clinical devices (Pelling et al. 2019).

The formation and structure of biofilms depend on factor varieties such as the type of microorganism, the type of surface, and environmental conditions such as pH and temperature. Physico-chemical characteristics such as the forces of electrostatic and hydrophobic attraction, interactions of var der Waals, hydrogen bonds, and covalent bonds are relevant to the formation of biofilm. Besides, genetic factors for bacterial adhesion are considered, such as the expression of flagella, polymers, and adhesion fimbriae (Flemming et al. 2016).

Although these data are relevant, the literature provides little information about the factors that contribute to the formation of biofilms in P. stuartii. In the case of urinary infections, there observed that to colonize the urinary tract, this microorganism can express resistance to calcium and magnesium, tolerates high concentrations of urea and pH variations (El-Khatib et al. 2017). But little is known about the cell adhesion processes of this species on biotic or abiotic surfaces. Thus, this study aimed to investigate cell hydrophobicity and genes encoding fimbrial adhesins in biofilm-forming P. stuartii isolates and compare with data found in other representatives of the Enterobacteriaceae family.

MATERIALS AND METHODS

Biological material and growing conditions

There investigated P. stuartii isolates (n = 28) from a public hospital in Recife-PE, Brazil. The samples were collected between June 2017 and April 2018 from a variety of infection sites and sectors of the hospital (Silva et al. 2021), which were stored in the Brain Heart Infusion (BHI) medium with glycerol (15%) in a Deep Freezer at -80 °C and with mineral oil at room temperature. Subsequently, they were reactivated and incubated at 37 °C for 24 hours. This study was approved by the Committee for Ethics in Research (CEP) of the Universidade Federal de Pernambuco (UFPE), and has Certificate of Presentation of Ethical Appreciation (CAAE) (number: 84509218.3.0000.5208).

Biofilm formation

Biofilm formation was carried out in polystyrene microplates by the violet crystal method described by Stepanović et al. (2007), with different culture media: BHI, Luria Bertani (LB), and Tryptose Soy Broth (TSB). After incubation (37 ºC/24h), the inoculum (1.5 × 10⁶ CFU/mL) was removed, the microplates were washed (3 ×) with 0.9% sterile saline, and the biofilm fixed (55 ºC/1h). Then, violet crystal (0.4%) was added at room temperature for 15 min, followed by three washes to remove excess dye. Finally, absolute ethanol was added for 30 min. From the optical density (OD) readings on a microplate reader (FLx800 ™ Multi-Detection - BioTec Instruments, Inc.) at wavelength 570 nm, there determined the mean of the absorbance values ​​of each sample (OD_S) in comparison with the absorbance of the sterility control (OD_C). The samples were classified as strong (4 × OD_C < OD_S), moderate (2 × OD_C < OD_S ≤ 4 × ODc), and weak (OD_C < OD_S ≤ 2 × OD_C) biofilm producer. For this assay, three independent and triplicate experiments were performed.

Fluorescence microscopy

An isolate (8945) was selected, capable of forming biofilm in the three media tested (BHI, LB, TSB) to confirm the biofilm formation. The tests, in triplicate, were repeated three times independently on polystyrene plates (six wells). 4 mL of each medium was added in separate wells, 0.5 mL of Milli-Q water and 0.5 mL of bacterial inoculum. For sterility control, the bacterial inoculum was replaced with distilled water sterilized. After incubation (37 ºC/24h), the plates were washed three times with 0.9% saline to remove planktonic cells. Then, SYBR Green (20 µL for each 1 mL of Milli-Q water) and Calcofluor White (1:1 with 10% KOH) were added in different wells to analyze the biofilm cells and the exopolysaccharide structure, respectively. The images were obtained under a fluorescence microscope (Leica DMLB Stand Tilting Trinocular Head) in filter 2 (BP 515-560) for SYBR Green and filter 1 (BP 480/40) for Calcofluor White.

Microbial adhesion test to hydrocarbons (MATH)

The Cell Surface Hydrophobicity (CSH) profile was determined based on the hydrocarbon bonding method described by Czerwonka et al. (2016), with some modifications. The bacterial isolates grown in BHI broth (37 °C/18h) were transferred to microtubes, centrifuged for 10 min (7,000 rpm), and the supernatant discarded. The resulting pellet was suspended in PUM buffer (phosphate potassium trihydrate and monobasic, urea, and sulfate magnesium heptahydrate) and adjusted to 0.5 (1.5 × 10⁶ CFU/mL) obtaining the initial OD reading (OD_i) at 600 nm. Subsequently, there added p-xylene hydrocarbon (1: 0.2), and the mixture was vortexed for 2 min. After the phase separation, at room temperature for 30 min, the final OD (OD_f) was performed at 600 nm of the lower phase of each microtube. The following formula was used to determine CSH (%): (OD_i - OD_f) / OD_i x 100. Bacteria with CSH (%) below 30% were considered hydrophilic and with CSH (%) higher than 70% as hydrophobic. Samples with CSH between 30% and 70% were classified as moderately hydrophobic (Tendolkar et al. 2004).

Genomic DNA extraction

DNA extraction was performed according to the protocol described by Sambrook & Russell (2001), with some modifications. The quality of the extracted DNA was evaluated using the 1% agarose gel electrophoresis technique. After the run, the gel was observed in a UV transilluminator and photo-documented. The DNA concentration was determined by optical density in a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) at wavelengths 260 and 280 nm, obtaining an estimate of the amount of DNA present in the sample and the degree of purity.

Genes identification by PCR

The amplification of the fimbriae encoding genes was performed by Polymerase Chain Reaction (PCR). For the fimH gene, the following sequence was used: F 5’ TCCACAGTCGCCAACGCTTC3’ and R 5’GCTCAGAATCAACATCGGTAAC3’. The sample amplifications were prepared for a final volume of 25 µL. It contains genomic DNA (20 ng), primer pairs (10 pmol), MgCl₂ (25 mM), dNTP (2 mM), Milli-Q water, Taq DNA polymerase (1 U), and sample buffer (25 mM). The reactions were carried out in a thermocycler (C1000^TM BioRad), programmed with the respective stages of denaturation, annealing, and extension (Stahlhut et al. 2009, Sahly et al. 2008). After amplification, the PCR was evaluated by electrophoresis on 1.2% agarose gel, using 100bp Ladder DNA marker (Invitrogen, Carlsbad, CA, USA). Then, the gel was observed in a UV transilluminator and photo-documented. A strain of Klebsiella pneumoniae (K5-A2), obtained from the Bacterial Culture Collection of the Laboratory of Bacteriology and Molecular Biology - Department of Tropical Medicine at UFPE, was used as a reference control.

RESULTS

All investigated P. stuartii isolates showed the ability to form biofilm in polystyrene microplates, with a high formation in BHI and TSB media, except for isolate 04446, which proved to be weak in the three media tested. The formation intensity can be evidenced through the optical density represented in Figure 1. Of the total isolates analyzed, 22 were classified as strong forming both in BHI and in TSB. However, in the LB medium, 23 showed moderate biofilm formation capacity (Figure 1, Table I).

Figure 1
Biofilm formation revealed with violet crystal. Biofilms prepared in polystyrene microplates were expressed by the mean optical density (OD) 570 nm and compared with the sterility control (SC). Brain Heart Infusions (BHI), Luria Bertani (LB), Tryptic Soy Broth (TSB).

Table I
Biochemical and genetic characteristics of the investigated isolates.

Isolates	Biofilm			Hidrophobicity	Genes
	BHI	LB	TSB		fimH	mrkD
8234	+++	++	+++	Hydrophilic	–	–
8686	+++	++	+++	Hydrophilic	–	–
8763	+++	++	+++	Hydrophilic	–	–
8944	++	++	++	Hydrophilic	–	–
8945	+++	+++	+++	Hydrophilic	–	–
8953	+++	++	+++	Hydrophilic	–	–
8972	+++	++	+++	Hydrophilic	–	–
10702	+++	++	+++	Hydrophilic	–	–
11255	+++	++	+++	Hydrophilic	–	–
11933	+++	++	+++	Hydrophilic	–	–
12353	+++	++	+++	MO Hydrophobic	–	–
12536	++	+++	++	Hydrophilic	–	–
12692	++	++	++	Hydrophilic	–	–
12953	+++	++	+++	Hydrophilic	–	–
13638	+++	++	+++	Hydrophilic	–	–
13646	+++	++	+++	Hydrophilic	–	–
13648	+++	++	+++	Hydrophilic	–	–
13684	+++	++	+++	Hydrophilic	–	–
13762	+++	++	+++	Hydrophilic	–	–
14051	+++	+++	+++	Hydrophilic	–	–
14569	+++	++	+++	Hydrophilic	–	–
15060	+++	++	+++	Hydrophilic	–	–
16995	++	++	++	Hydrophilic	–	–
17852	+++	++	+++	Hydrophilic	–	–
18809	++	++	++	Hydrophilic	–	–
01011	+++	+++	+++	Hydrophilic	–	–
01474	+++	++	+++	Hydrophilic	–	–
04446	+	+	+	Hydrophilic	–	–

• Strong biofilm producer (+++), moderate biofilm producer (++), weak biofilm producer (+). Brain Heart Infusions (BHI), Luria Bertani (LB), Tryptic Soy Broth (TSB). Hydrophobic MO: moderately hydrophobic. Absent gene (–).

There used fluorescence microscopy to confirm the formation. According to the results obtained by the violet crystal method, isolate 8945 was selected, evaluated as a strong former in the three investigated media. It was possible to observe biofilm in the samples stained with SYBR Green for the three media (Figure 2a, b, c), as well as the formation of exopolysaccharide matrix (EPS) from staining with Calcofluor White (Figure 2d, e, f). In Figures 2g, b, i, there possible to verify the overlap of the previous images revealing the fundamental structures that characterize the bacterial biofilm.

Figure 2
Biofilm of isolate 8945 under fluorescence microscopy. a), b) and c): biofilm formed in BHI, LB and TSB and Stained with SYBR Green. d), e) and f): exopolysaccharides stained with Calcofluor White, respectively. g), h) and i): biofilm cells stained with SYBR Green and Calcofluor White, respectively.

To the CSH profile, there classified 27 isolates as hydrophilic, with a hydrophobicity below 30%. Only the isolate 12353 showed a percentage between 30% and 70% and was therefore classified as moderately hydrophobic (Figure 3, Table I).

Figure 3
Percentage of the cell surface hydrophobicity (CSH) profile of P. stuartii isolates, represented by the mean of three bacterial suspensions in p-xylene (1: 0.2).

Once analyzed the capacity for biofilm formation and the hydrophobicity profile of the isolates, there also investigated genes related to the biofilm formation mechanism such as mrkD and fimH and their prevalence in the main species from the Enterobacteriaceae family. Interestingly, none of the isolates investigated in the present study were positive for these genes (Figure 4, Table I).

Figure 4
Gel representative of the amplification products of the a) fimH and b) mrkD genes. M: Molecular marker; C+: Positive control (K. pneumoniae / K5-A2), C–: Negative control (milliQ water). 1: 8234, 2: 8945, 3: 01011.

DISCUSSION

The structural stability of the biofilm gives the involved bacteria a suitable microenvironment for their survival. It acts as a barrier and, consequently, protecting the entire resident community from antimicrobials and the host immune system. In this way, there characterized biofilm as a great virulence mechanism (Flemming et al. 2016).

In the present study, all isolates were able to biofilm form but with different intensities, especially in BHI and TSB media. However, under the conditions tested, there characterized the isolate 04446 as a weak producer. Our data corroborate Silva et al. (2020) study that analyzed the biofilm formation capacity of Proteus mirabilis isolates, a species of Enterobacteriaceae, as well as P. stuartii. In which there observed a higher formation in these two culture media. Similarly, another study evaluated the biofilm formation in Acinetobacter baumannii and Pseudomonas aeruginosa in LB and TSB media in standard concentrations, supplemented with glucose and diluted (25% of the standard) (Lima et al. 2020). Some isolates of these species responded to stress treatments only in TSB. For the authors, the medium dilution that resulted in the nutrient reduction may have induced a higher biofilm formation. Based on these results, isolate 04446 from P. stuartii may be capable of form more biofilm if subjected to some stress condition.

Regarding the hydrophobicity profile, there observed no relevant differences between CSH and biofilm formation. The only isolate classified as moderately hydrophobic (12353) presented a percentage closer to the hydrophilic profile and formed biofilm similarly to other isolates. Unlike most studies, our data agree with previous studies that observed higher formation when the bacteria had hydrophilic cell surfaces (Czerwonka et al. 2016, Araújo et al. 2019, Silva et al. 2020). Moreover, a study has shown that P. stuartii is capable of adhering and invading epithelial cells effectively, according to its growth stage (Kurmasheva et al. 2018). Therefore, the data presented here is relevant, mainly because CSH is one of the main physicochemical factors that influence the process of microbial adhesion on substrates. It is noteworthy that most bacterial cells and some surfaces are negatively charged, thus enabling electrostatic repulsion. This fact has contributed significantly to the synthesis of anti-infectious clinical devices, thus preventing microbial adhesion and, consequently, pathogens dissemination in the hospital environment (Trentin et al. 2015, Ren et al. 2018).

For the formation and structure of biofilms, there required a variety of physical-chemical and genetic factors. A study that investigated the biofilm of P. stuartii found that in the planktonic state, this species forms communities of floating cells that precede and later coexist with biofilms attached to the surface, showing the specificity of this species related to this virulence factor (El-Khatib et al. 2018). Another study investigated the flexibility of the main porins of this bacterium (OmpPst1 and OmpPst2) and suggested that the movements, especially of OmPst1, may contribute to the adaptation of this species in the environment by interacting with other membrane components such as LPS, important exopolysaccharides in the processes of biofilm formation (Tran et al. 2017). Possibly, the diversity of amino acid residues present in the external domain of this porin helps charge movements and electrostatic interactions with other components of the cell membrane (Arunmanee et al. 2016).

Among the genetic factors related to biofilm formation, a diversity of fimbrial adhesins stand out, especially in gram-negative bacteria. It can promote cell adhesion and contribute to the development of biofilm. These adhesins interact with specific receptors present on inert and biotic surfaces and can be encoded by chromosomal or plasmid genes (Zamani & Salehzadeh 2018). In the present study, there investigated genes encoding fimbriae of type 1 (fimH) and type 3 (mrkD), which are identified in different species of the Enterobacteriaceae family (Table II), as well as in bacteria from other families (Mohajeri et al. 2016, Tavakol et al. 2018).

Table II
Detection of fimH and mrkD genes in species from Enterobacteriaceae family.

Gene	Enterobacteriaceae	References
fimH	Edwardsiella piscicida	Zhang et al. (2019)
	Enterobacter aerogenes	Azevedo et al. (2018)
	Escherichia coli	Feenstra et al. (2017), Chen et al. (2018), Rabbani et al. (2018), Zhang et al. (2020)
	Klebsiella pneumoniae	Ferreira et al. (2019)
	Klebsiella oxytoca	Ghasemian et al. (2018)
	Salmonella enterica Enterica	Rakov et al. (2019)
	Salmonella enterica serovar Enteritidis	Kuźmińska-Bajor et al. (2012, 2015)
	Salmonella enterica serovar Choleraesuis	Grzymajlo et al. (2013), Lee & Yeh (2016)
	Salmonella enterica serovar Typhimurium	Zeiner et al. (2012), Uchiya et al. (2019)
mrkD	Citrobacter freundii	Ong et al. (2010)
	Citrob acter koseri	Ong et al. (2010)
	Enterobacter aerogenes	Azevedo et al. (2018)
	Enterobacter cloacae	Amaretti et al. (2020)
	Escherichia coli	Ong et al. (2010), Stahlhut et al. (2013)
	Klebsiella oxytoca	Ong et al. (2010), Ghasemian et al. (2018)
	Klebsiella pneumoniae	Ong et al. (2010), Stahlhut et al. (2013), Ferreira et al. (2019), Imai et al. (2019), Amaretti et al. (2020)
	Klebsiella quasipneumoniae	Imai et al. (2019)
	Klebsiella variicola	Imai et al. (2019)

There frequently identified the type 1 fimbriae in uropathogenic E. coli (UPEC), and it is one of the relevant factors in the adhesion of these pathogens (Zamani & Salehzadeh 2018). But they are also identified in other enterobacteria such as Klebsiella spp. and Samonella spp. among others (Araújo et al. 2019, Uchiya et al. 2019). Likewise, type 3 fimbriae in some other bacteria in this family (Stahlhut et al. 2013, Azevedo et al. 2018), as seen in Table II.

Given this information and considering the specificities already related to the virulence mechanism described for P. stuartii, the present study investigated the fimH and mrkD genes related to bacterial invasion and colonization processes in the urinary tract. However, in the present study, there found no presence of neither of these two genes. To the fimH, there are no reports of investigation in this species, even though it encodes an essential structure for the invasion and colonization by bacteria, especially the urinary tract. While for mrkD, the possible association of this gene with the persistence of P. stuartii in cases of bacteriuria was reported in the 1980s (Mobley et al. 1988). However, there found no more recent experimental studies using molecular tools, that could confirm the presence of this sequence in this pathogen genome.

The absence of the two investigated genetic sequences in the present study indicates that, possibly, these genes do not correspond to determining factors for the formation of biofilms in P. stuartii, differently from what was found for other representatives of the Enterobacteriaceae (Table II). This information is interesting and reveals that this species has specific genetic and biochemical features not yet described or little known in species of that family.

These data demonstrate that understanding and clarifying possible mechanisms involved in bacterial biofilm formation is essential for understanding the composition of the extracellular matrix, subtypes, and cell behaviors. Also, the adhesion mechanisms involved in the survival and permanence of P. stuartii in the colonization process to, eventually, prevent or control chronic infections caused by this pathogen. The data presented here reinforce the need for further studies due to the specificities found in this species. These particularities have revealed an increase in the resistance profile (Silva et al. 2020) and survival of this bacterium in the hospital environment, making it difficult, therefore, to fight the possible infections.

CONCLUSIONS

In conclusion, our results confirm and demonstrate some specificities of P. stuartii regarding its potential for biofilm formation. The hydrophilic cell surface of this bacterium indicates that interaction with the abiotic surface investigated in this study may occur and, consequently, may facilitate cell-cell interaction. Additionally, other types of fimbrial adhesins not yet reported in the literature may be related to your biofilm formation. Thus, this study reinforces the need for further research to eventually prevent chronic bacterial infections and assist clinical treatments.

ACKNOWLEDGMENTS

We thank the Laboratory of Genetics and Plant Biology for the fluorescence microscopy.

REFERENCES

• ABDALLAH M & BALSHI A. 2018. First literature review of carbapenem-resistant Providencia. New Microbes New Infect 25: 16-23.
• AIRES CAM, ALMEIDA ACS, VILELA MA, MORAIS-JUNIOR MA & MORAIS MMC. 2016. Selection of KPC-2-producing Providencia stuartii during treatment for septicemia. Diagn Microbiol Infect Dis 84: 95-96.
• AMARETTI A, RIGHINI L, CANDELIERE F, MUSMECI E, BONVICINI F, GENTILOMI GA, ROSSI M & RAIMONDI S. 2020. Antibiotic Resistance, Virulence Factors, Phenotyping, and Genotyping of Non-Escherichia coli Enterobacterales from the Gut Microbiota of Healthy Subjects. Int J Mol Sci 21: 1847.
• ARAÚJO LCA ET AL. 2019. In vitro evaluation of mercury (Hg2+) effects on biofilm formation by clinical and environmental isolates of Klebsiella pneumoniae. Ecotoxicol Environ Saf 169: 669-677.
• ARMBRUSTER CE, SMITH SN, YEP A & MOBLEY HL. 2014. Increased incidence of urolithiasis and bacteremia during Proteus mirabilis and Providencia stuartii coinfection due to synergistic induction of urease activity. J Infect Dis 15: 1524-1532.
• ARUNMANEE W, PATHANIA M, SOLOVYOVA AS, LE BRUN AP, RIDLEY H, BASLÉ A, VAN DEN BERG B & LAKEY JH. 2016. Gram-negative trimeric porins have specific LPS binding sites that are essential for porin biogenesis. Proc Natl Acad Sci U S A 113: 5034-5043.
• AZEVEDO PAA, FURLAN JPR, SILVA MO, SILVA RN, GOMES CN, COSTA KRC, STEHLING EG & SILVA AP. 2018. Detection of virulence and β-lactamase encoding genes in Enterobacter aerogenes and Enterobacter cloacae clinical isolates from Brazil. Braz J Microbiol 49: 224-228.
• CHEN Z, PHAN MD, BATES LJ, PETERS KM, MUKERJEE C, MOORE KH & SCHEMBRI MA. 2018. The urinary microbiome in patients with refractory urge incontinence and recurrent urinary tract infection. Int Urogynecol J 29: 1775-1782.
• CLSI – CLINICAL AND LABORATORY STANDARDS INSTITUTE. 2018. Performance standards for antimicrobial susceptibility testing. 28th ed, CLSI supplement M100, Wayne, PA.
• CRANE ES, SHUM M & CHU DS. 2016. Case report: Providencia stuartii conjunctivitis. J Ophthalmic Inflamm Infect 6: 29.
• CZERWONKA G, GUZY A, KAŁUŻA K, GROSICKA M, DAŃCZUK M, LECHOWICZ Ł, GMITER D, KOWALCZYK P & KACA W. 2016. The role of Proteus mirabilis cell wall features in biofilm formation. Arch Microbiol 198: 877-884.
• EL-KHATIB M ET AL. 2018. Porin self-association enables cell-to-cell contact in Providencia stuartii floating communities. Proc Natl Acad Sci U S A 115: 2220-2228.
• EL-KHATIB M, TRAN QT, NASRALLAH C, LOPES J, BOLLA JM, VIVAUDOU M, PAGÈS JM & COLLETIER JP. 2017. Providencia stuartii form biofilms and floating communities of cells that display high resistance to environmental insults. PLoS ONE 12: 0174213.
• FEENSTRA T ET AL. 2017. Adhesion of Escherichia coli under flow conditions reveals potential novel effects of FimH mutations. Eur J Clin Microbiol Infect Dis 36: 467-478.
• FERREIRA RL ET AL. 2019. High Prevalence of Multidrug-Resistant Klebsiella pneumoniae Harboring Several Virulence and β-Lactamase Encoding Genes in a Brazilian Intensive Care Unit. Front Microbiol 9: 3198.
• FLEMMING HC, WINGENDER J, SZEWZYK U, STEINBERG P, RICE SA & KJELLEBERG S. 2016. Biofilms: an emergent form of bacterial life. Nat Rev Microbiol 14: 563-575.
• GEORGE EA, KORNIK R & ROBINSON-BOSTOM L. 2020. Providencia stuartii septic vasculitis. JAAD Case Rep 6: 422-425.
• GHASEMIAN A, MOBAREZ AM, PEERAYEH SN & ABADI ATB. 2018. The association of surface adhesin genes and the biofilm formation among Klebsiella oxytoca clinical isolates. New Microbes New Infect 27: 36-39.
• GRZYMAJLO K, UGORSKI M, KOLENDA R, KĘDZIERSKA A, KUZMINSKA-BAJOR M & WIELICZKO A. 2013. FimH adhesin from host unrestricted Salmonella Enteritidis binds to different glycoprotein ligands expressed by enterocytes from sheep, pig and cattle than FimH adhesins from host restricted Salmonella Abortus-ovis, Salmonella Choleraesuis and Salmonella Dublin. Vet Microbiol 166: 550-557.
• IMAI K ET AL. 2019. Clinical characteristics in blood stream infections caused by Klebsiella pneumoniae, Klebsiella variicola, and Klebsiella quasipneumoniae: a comparative study, Japan, 2014-2017. BMC Infect Dis 19: 946.
• KURMASHEVA N, VOROBIEV V, SHARIPOVA M, EFREMOVA T & MARDANOVA A. 2018. The Potential Virulence Factors of Providencia stuartii: Motility, Adherence, and Invasion. Biomed Res Int 21: 3589135.
• KUŹMIŃSKA-BAJOR M, GRZYMAJLO K & UGORSKI M. 2015. Type 1 fimbriae are important factors limiting the dissemination and colonization of mice by Salmonella Enteritidis and contribute to the induction of intestinal inflammation during Salmonella invasion. Front Microbiol 6: 276.
• KUŹMIŃSKA-BAJOR M, KUCZKOWSKI M, GRZYMAJLO K, WOJCIECH Ł, SABAT M, KISIELA D, WIELICZKO A & UGORSKI M. 2012. Decreased colonization of chicks by Salmonella enterica serovar Gallinarum expressing mannose-sensitive FimH adhesin from Salmonella enterica serovar Enteritidis. Vet Microbiol 158: 205-210.
• LEE CA & YEH KS. 2016. The Non-Fimbriate Phenotype Is Predominant among Salmonella enterica Serovar Choleraesuis from Swine and Those Non-Fimbriate Strains Possess Distinct Amino Acid Variations in FimH. PLoS ONE 11: 0151126.
• LEE TY, WANG CW, CHEN TW, LIAO GS, FAN HL & CHAN DC. 2017. Refractory urinary tract infection complicated rectus sheath abscess: A case report. Urol Case Rep 16: 81-82.
• LIBERTUCCI J, BASSIS CM, CASSONE M, GIBSON K, LANSING B, MODY L, YOUNG VB & MEDDINGS J. 2019. Bacteria Detected in both Urine and Open Wounds in Nursing Home Residents: a Pilot Study. mSphere 4: 00463-19.
• LIMA AVA ET AL. 2020. Occurrence and Diversity of Intra- and Interhospital Drug-Resistant and Biofilm-Forming Acinetobacter baumannii and Pseudomonas aeruginosa. Microb Drug Resist 26: 802-814.
• LIN K, LIN AN, LINN S, REDDY M & BAKSHI A. 2017. Recurrent Primary Suprahepatic Abscess Due to Providencia Stuartii: A Rare Phenomenon. Cureus 9: 1691.
• MAGIORAKOS AP ET AL. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18: 268-281.
• MAO YC, CHANG CL, HUANG YC, SU LH & LEE CT. 2018. Laboratory investigation of a suspected outbreak caused by Providencia stuartii with intermediate resistance to imipenem at a long-term care facility. J Microbiol Immunol Infect 51: 214-219.
• MIRÓ E, GRÜNBAUM F, GÓMEZ L, RIVERA A, MIRELIS B, COLL P & NAVARRO F. 2013. Characterization of aminoglycoside-modifying enzymes in Enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion. Microb Drug Resist 19: 94-99.
• MOBLEY HL, CHIPPENDALE GR, TENNEY JH, MAYRER AR, CRISP LJ, PENNER JL & WARREN JW. 1988. MR/K hemagglutination of Providencia stuartii correlates with adherence to catheters and with persistence in catheter-associated bacteriuria. J Infect Dis 157: 264-271.
• MOHAJERI P, SHARBATI S, FARAHANI A & REZAEI Z. 2016. Evaluate the frequency distribution of nonadhesive virulence factors in carbapenemase-producing Acinetobacter baumannii isolated from clinical samples in Kermanshah. J Nat Sci Biol Med 7: 58-61.
• MOLNÁR S, FLONTA MMM, ALMAŞ A, BUZEA M, LICKER M, RUS M, FÖLDES A & SZÉKELY E. 2019. Dissemination of NDM-1 carbapenemase-producer Providencia stuartii strains in Romanian hospitals: a multicentre study. J Hosp Infect 103: 165-169.
• OIKONOMOU O, LIAKOPOULOS A, PHEE LM, BETTS J, MEVIUS D & WAREHAM DW. 2016. Providencia stuartii Isolates from Greece: Co-Carriage of Cephalosporin (blaSHV-5, blaVEB-1), Carbapenem (blaVIM-1), and Aminoglycoside (rmtB) Resistance Determinants by a Multidrug-Resistant Outbreak Clone. Microb Drug Resist 22: 379-386.
• ONG CL, BEATSON SA, TOTSIKA M, FORESTIER C, MCEWAN AG & SCHEMBRI MA. 2010. Molecular analysis of type 3 fimbrial genes from Escherichia coli, Klebsiella and Citrobacter species. BMC Microbiol 10: 183.
• PELLING H, NZAKIZWANAYO J, MILO S, DENHAM EL, MACFARLANE WM, BOCK LJ, SUTTON JM & JONES BV. 2019. Bacterial biofilm formation on indwelling urethral catheters. Lett Appl Microbiol 68: 277-293.
• PIRII LE, FRIEDRICH AW, ROSSEN JWA, VOGELS W, BEERTHUIZEN GIJM, NIEUWENHUIS MK, KOOISTRA-SMID AMD & BATHOORN E. 2018. Extensive colonization with carbapenemase-producing microorganisms in Romanian burn patients: infectious consequences from the Colectiv fire disaster. Eur J Clin Microbiol Infect Dis 37: 175-183.
• RABBANI S, FIEGE B, ERIS D, SILBERMANN M, JAKOB RP, NAVARRA G, MAIER T & ERNST B. 2018. Conformational switch of the bacterial adhesin FimH in the absence of the regulatory domain: Engineering a minimalistic allosteric system. J Biol Chem 293: 1835-1849.
• RAKOV AV, MASTRIANI E, LIU SL & SCHIFFERLI DM. 2019. Association of Salmonella virulence factor alleles with intestinal and invasive serovars. BMC Genomics 20: 429.
• REN Y, WANG C, CHEN Z, ALLAN E, VAN DER MEI HC & BUSSCHER HJ. 2018. Emergent heterogeneous microenvironments in biofilms: substratum surface heterogeneity and bacterial adhesion force-sensing. FEMS Microbiol Rev 42: 259-272.
• SAHLY H, NAVON-VENEZIA S, ROESLER L, HAY A, CARMELI Y, PODSCHUN R, HENNEQUIN C, FORESTIER C & OFEK I. 2008. Extended-spectrum beta-lactamase production is associated with an increase in cell invasion and expression of fimbrial adhesins in Klebsiella pneumoniae. Antimicrob Agents Chemother 52: 3029-3034.
• SAMBROOK J & RUSSELL DW. 2001. Molecular Cloning: A laboratory manual. Cold Spring Harbor Laboratory 3rd ed, New York, p. 612-670.
• SANTIAGO GS, MOTTA CC, BRONZATO GF, GONÇALVES D, SOUZA MMS, COELHO IS, FERREIRA HN & COELHO SMO. 2016. A Review: AmpC β-lactamase production in Enterobacteriaceae. Braz J Vet Medicine 38: 17-30.
• SHIMA A, HINENOYA A, SAMOSORNSUK W, SAMOSORNSUK S, MUNGKORNKAEW N & YAMASAKI S. 2016. Prevalence of Providencia Strains among Patients with Diarrhea and in Retail Meats in Thailand. Jpn J Infect Dis 69: 323-325.
• SILVA S, ARAÚJO L, NASCIMENTO JUNIOR JA, SILVA T, LOPES AC, CORREIA MT, SILVA M & OLIVEIRA MB. 2020. Effects of Cefazolin and Meropenem in Eradication Biofilms of Clinical and Environmental Isolates of Proteus mirabilis. Curr Microbiol 77: 1681-1688.
• SILVA SM, RAMOS BA, LIMA AVA, SÁ RACQ, LIMA JLC, MACIEL MAV, PAIVA PMG, SILVA MV, CORREIA MTS & OLIVEIRA MBM. 2021. First report of the aac(6’)-Ib-cr gene in Providencia stuartii isolates in Brazil. Rev Soc Bras Med Trop 54: e20190524.
• STAHLHUT SG, CHATTOPADHYAY S, KISIELA DI, HVIDTFELDT K, CLEGG S, STRUVE C, SOKURENKO EV & KROGFELT KA. 2013. Structural and population characterization of MrkD, the adhesive subunit of type 3 fimbriae. J Bacteriol 195: 5602-5613.
• STAHLHUT SG, CHATTOPADHYAY S, STRUVE C, WEISSMAN SJ, APRIKIAN P, LIBBY SJ, FANG FC, KROGFELT KA & SOKURENKO EV. 2009. Population variability of the FimH type 1 fimbrial adhesin in Klebsiella pneumoniae. J Bacteriol 191: 1941-1950.
• STEPANOVIĆ S, VUKOVIĆ D, HOLA V, DI BONAVENTURA G, DJUKIĆ S, CIRKOVIĆ I & RUZICKA F. 2007. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 115: 891-899.
• TAVAKOL M, MOMTAZ H, MOHAJERI P, SHOKOOHIZADEH L & TAJBAKHSH E. 2018. Genotyping and distribution of putative virulence factors and antibiotic resistance genes of Acinetobacter baumannii strains isolated from raw meat. Antimicrob Resist Infect Control 7: 120.
• TENDOLKAR PM, BAGHDAYAN AS, GILMORE MS & SHANKAR N. 2004. Enterococcal surface protein, Esp, enhances biofilm formation by Enterococcus faecalis. Infect Immun 72: 6032-6039.
• TRAN QT, MAIGRE L, D’AGOSTINO T, CECCARELLI M, WINTERHALTER M, PAGÈS JM & DAVIN-REGLI A. 2017. Porin flexibility in Providencia stuartii: cell-surface-exposed loops L5 and L7 are markers of Providencia porin OmpPst1. Res Microbiol 168: 685-699.
• TRENTIN DS ET AL. 2015. Natural Green coating inhibits adhesion of clinically important bacteria. Sci Rep 5: 8287.
• UCHIYA KI, KAMIMURA Y, JUSAKON A & NIKAI T. 2019. Salmonella Fimbrial Protein FimH Is Involved in Expression of Proinflammatory Cytokines in a Toll-Like Receptor 4-Dependent Manner. Infect Immun 87: 00881-18.
• ZAMANI H & SALEHZADEH A. 2018. Biofilm formation in uropathogenic Escherichia coli: association with adhesion factor genes. Turk J Med Sci 48: 162-167.
• ZEINER SA, DWYER BE & CLEGG S. 2012. FimA, FimF, and FimH are necessary for assembly of type 1 fimbriae on Salmonella enterica serovar Typhimurium. Infect Immun 80: 3289-3296.
• ZHANG Q, HE TT, LI DY, LIU LY, NIE P & XIE HX. 2019. The Edwardsiella piscicida Type III Effector EseJ Suppresses Expression of Type 1 Fimbriae, Leading to Decreased Bacterial Adherence to Host Cells. Infect Immun 87: 00187-19.
• ZHANG W, XU L, PARK HB, HWANG J, KWAK M, LEE PCW, LIANG G, ZHANG X, XU J & JIN JO. 2020. Escherichia coli adhesion portion FimH functions as an adjuvant for cancer immunotherapy. Nat Commun 11: 1187.

Publication Dates

• Publication in this collection
  05 Sept 2022
• Date of issue
  2022

History

• Received
  26 May 2021
• Accepted
  18 Nov 2021