Frequency and factors associated with Theileria equi, Babesia caballi and Trypanosoma evansi in equids from Bahia (Northeast Brazil)

Costa, Sonia Carmen Lopo; Freitas, Jéssica de Souza; Silva, Aísla Nascimento da; Lacerda, Luciana Carvalho; Cruz, Rebeca Dálety Santos; Carvalho, Fábio Santos; Pereira, Maria Julia Salim; Munhoz, Alexandre Dias

doi:10.1590/S1984-296120180090

Acessibilidade / Reportar erro

Brasil

Revista Brasileira de Parasitologia Veterinária

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original Article • Rev. Bras. Parasitol. Vet. 28 (1) • Jan-Mar 2019 • https://doi.org/10.1590/S1984-296120180090 copy

Frequency and factors associated with Theileria equi, Babesia caballi and Trypanosoma evansi in equids from Bahia (Northeast Brazil)

Frequência e fatores associados a Theileria equi, Babesia caballi e Trypanosoma evansi em equídeos da Bahia (Nordeste do Brasil)

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

The aim of this study was to determine the frequency and factors associated to Babesia caballi, Theileria equi and Trypanosoma evansi in naturally infected equids from the northeast Brazil. Blood samples from 569 equids (528 horses, 8 mules, and 33 donkeys) were collected and tested for the presence of DNA of each of these protozoan parasites by PCR. Generalized linear models were used to evaluate risk factors associated with the infection. The frequency of T. equi infection was 83.5% (475/569) - 84.3% in horses, and 73.2% in donkeys and mules. The results of the final model indicated that age (senior group) and animal species (mule and donkey group) were protective factors against this pathogen. The frequency of B. caballi infection was 24.3% (138/569) - 23.5% in horses and 34.1% in donkeys and mules. Age (adult and senior group) was considered a protective factor against B. caballi infection whereas animal species (donkey and mule group) were considered a risk factor for the infection. Trypanosoma evansi infection was not detected in any of animals. Our results suggest that equids from the area studied may be infected earlier in life with the etiological agents of equine piroplasmosis and become asymptomatic carriers.

Keywords:
Piroplasmosis; trypanosomiasis; epidemiology; horses; mules; donkeys

Agent	Code	Sequence of oligonucleotides (5’-3’)	Reaction (Fragment)	Reference
Theileria equi	EMAE-F	CCGCCCTTCACCTCGTTCTCAA	1ª (396bp ^* * Base pairs. )	Nicolaiewsky et al. (2001) Nicolaiewsky TB, Richter MF, Lunge VR, Cunha CW, Delagostin O, Ikuta N, et al. Detection of Babesia equi (Laveran, 1901) by nested polymerase chain reaction. Vet Parasitol 2001; 101(1): 9-21. http://dx.doi.org/10.1016/S0304-4017(01)00471-X. PMid:11587829. http://dx.doi.org/10.1016/S0304-4017(01...
	EMAE-R	TCTCGGCGGCATCCTTGACCTC	1ª (396bp ^* * Base pairs. )
	EMAI-F	CCGTCTCCGTTGACTTGGCCG	2ª (102bp ^* * Base pairs. )
	EMAI-R	GGACGCGCTTGCCTGGAGCCT	2ª (102bp ^* * Base pairs. )
Babesia caballi	BC48F1	ACGAATTCCCACAACAGCCGTGT	1ª (530bp ^* * Base pairs. )	Ikadai et al. (1999) Ikadai H, Xuan X, Igarashi I, Tanaka S, Kanemaru T, Nagasawa H, et al. Cloning and expression of a 48-kilodalton Babesia caballi merozoite rhoptry protein and potential use of the recombinant antigen in an enzyme-linked immunosorbent assay. J Clin Microbiol 1999; 37(11): 3475-3480. PMid:10523537.
	BC48R3	ACGAATTCGTAAAGCGTGGCCAT	1ª (530bp ^* * Base pairs. )
	BC48F11	GGGCGACGTGACTAAGACCTTAT	2ª (430bp ^* * Base pairs. )	Battsetseg et al. (2002) Battsetseg B, Lucero S, Xuan X, Claveria FG, Inoue N, Alhassan A, et al. Detection of natural infection of Boophilus microplus with Babesia equi and Babesia caballi in Brazilian horses using nested polymerase chain reaction. Vet Parasitol 2002; 107(4): 351-357. http://dx.doi.org/10.1016/S0304-4017(02)00131-0. PMid:12163246. http://dx.doi.org/10.1016/S0304-4017(02...
	BC48R31	GTTCTCAATGTCAGTAGCATCCG	2ª (430bp ^* * Base pairs. )
Trypanosoma evansi	TBR1	GAATATTAAACAATGCGCAG	1ª (164bp ^* * Base pairs. )	Masiga et al. (1992) Masiga DK, Smyth AJ, Hayes P, Bromidge TJ, Gibson WC. Sensitive detection of trypanosomes in tsetse flies by DNA amplification. Int J Parasitol 1992; 22(7): 909-918. http://dx.doi.org/10.1016/0020-7519(92)90047-O. PMid:1459784. http://dx.doi.org/10.1016/0020-7519(92)...
Trypanosoma evansi	TBR2	CCATTTATTAGCTTTGTTGC	1ª (164bp ^* * Base pairs. )
GAPDH	gapF	CCTTCATTGACCTCAACTACAT	1ª (400bp ^* * Base pairs. )	Birkenheuer et al. (2003) Birkenheuer AJ, Levy MG, Breitschwerdt EB. Development and Evaluation of a Seminested PCR for Detection and Differentiation of Babesia gibsoni (Asian Genotype) and B. canis DNA in Canine Blood Samples. J Clin Microbiol 2003; 41(9): 4172-4177. http://dx.doi.org/10.1128/JCM.41.9.4172-4177.2003. PMid:12958243. http://dx.doi.org/10.1128/JCM.41.9.4172...
GAPDH	gapR	CCAAAGTTGTCATGGATGACC	1ª (400bp ^* * Base pairs. )

Variable	Equidae				Odds ratio	P
Variable	Positive (%)		Negative (%)		(95% CI)	P
Sex
Male	121	85.8	20	14.2	1.18 (0.68-2.03)	0.56
Female (Ref)	314	83.7	61	16.3
Species
Horses (Ref)	405	85.3	70	14.7
Donkey or mule	30	73.2	11	26.8	0.47 (0.23-0.98)	0.05
Animals kept in stables
Yes (ref)	41	85.4	7	14.6
No	394	84.2	74	15.8	0.91 (0.39-2.10)	0.82
Contact with cattle
Yes	369	84.4	68	15.6	1.07 (0.56-2.04)	0.84
No (Ref)	66	83.5	13	16.5
Contact with goats
Yes	53	88.3	7	11.7	1.47 (0.64-3.35)	0.36
No (Ref)	382	83.8	74	16.2
Contact with poultry
Yes	376	84.1	71	15.9	0.90 (0.44-1.84)	0.77
No (Ref)	59	85.5	10	14.5
Contact with sheep
Yes	96	90.6	10	9.4	2.01 (1,00-4.05)	0.05
No (ref.)	339	82.7	71	17.3
Rats in the farm
Yes	347	84.4	64	15.6	1.05 (0.58-1.88)	0.88
No(ref)	88	83.8	17	16.2
Toxic plants in the farm
Yes	194	84.0	37	16	0.96 (0.59-1.54)	0.86
No (Ref)	241	84.6	44	15.4
Age range
Young (Ref)	80	93.0	6	7.0
Adult	227	90.4	24	9.6	0.71 (0.28-1.80)	0.47
Senior	128	71.5	51	28.5	0.19 (0.08-0.46)	<0.01

Variable	Category	Odds ratio (95% CI)	P
Sex	Female (Ref)
	Male	0.94 (0.47-1.92)	0.87
Species	Horses (Ref)
	Donkey or mule	0.45 (0.19-1.02)	<0.01
Animals kept in stables	Yes (Ref)
	No	1.94 (0.75-4.99)	0.17
Contact with cattle	No (Ref)
	Yes	0.81 (0.34-1.92)	0.63
Contact with goats	No (Ref)
	Yes	0.57 (0.11-3.01)	0.51
Contact with poultry	No (Ref)
	Yes	0.79 (0.31-2.03)	0.63
Contact with sheep	No (Ref)
	Yes	2.96 (0.83-10.59)	0.09
Rats in the farm	No (Ref)
	Yes	1.09 (0.53-2.24)	0.81
Toxic plants in the farm	No (Ref)
	Yes	0.84 (0.43-1.62)	0.60
Age range	Young (Ref)
	Adult	0.66 (0.25-1.73)	0.40
	Senior	0.15 (0.06-0.40)	<0.01

Variable	Category	Odds ratio (95% CI)	P
Species	Horses (Ref)
	Donkey or mule	0.41 (0.19-0.89)	0.02
Age range	Young (Ref)
	Adult	0.77 (0.30-1.96)	0.58
	Senior	0.19 (0.08-0.47)	<0.01

Variable	Equidae				Odds ratio	P
Variable	Positive (%)		Negative (%)		(95% CI)
Sex
Male	43	30.3	98	69.5	1.43 (0.85-2.40)	0.17
Female (Ref)	86	22.9	289	71.1
Species
Horses (Ref)	115	24.2	360	65.8
Donkey or mule	14	34.1	27	61.9	2.02 (0.90-4.55)	0.09
Animals kept in stables
Yes (ref)	22	45.8	26	54.2
No	107	22.9	361	77.1	0.33 (0.17-0.64)	<0.01
Contact with cattle
Yes	114	26.0	323	73.9	1.68 (0.69-4.07)	0.25
No (Ref)	15	19.0	64	81.0
Contact with goats
Yes	6	10.0	54	90.0	0.29 (0.11-0.78)	0.01
No (Ref)	123	27.0	333	73.0
Contact with poultry
Yes	108	24.2	339	75.8	0.67 (0.30-1.50)	0.33
No (Ref)	21	30.4	48	69.6
Contact with sheep
Yes	17	16.0	89	84.0	0.54 (0.26-1.10)	0.09
No (ref.)	112	27.3	298	72.7
Rats in the farm
Yes	96	23.4	315	76.6	0.62 (0.32-1.20)	0.16
No(ref)	33	31.4	72	68.0
Toxic plants in the farm
Yes	50	21.6	1.8	78.4	0.74 (0.42-1.33)	0.32
No (Ref)	79	27.7	206	72.3
Age range
Young (Ref)	53	61.6	33	38.4
Adult	59	23.5	192	76.5	0.19 (0.11-0.33)	<0.001
Senior	17	9.5	162	90.3	0.05 (0.03-0.11)	<0.001

Variable	Category	Odds ratio (95% CI)	P
Sex	Female (Ref)
	Male	0.81 (0.44-1.52)	0.52
Species	Horses (Ref)
	Donkey or mule	2.42 (0.95-6.14)	0.06
Animals kept in stables	Yes (Ref)
	No	0.49 (0.22-1.09)	0.08
Contact with cattle	No (Ref)
	Yes	1.73 (0.66-4.53)	0.27
Contact with goats	No (Ref)
	Yes	0.21 (0.04-1.09)	0.06
Contact with poultry	No (Ref)
	Yes	1.23 (0.51-2.97)	0.64
Contact with sheep	No (Ref)
	Yes	1.24 (0.45-3.43) 0.68	0.68
Rats in the farm	No (Ref)
	Yes	0.72 (0.34-1.53)	0.39
Toxic plants in the farm	No (Ref)
	Yes	1.20 (0.61-2.36)	0.59
Age range	Young (Ref)
	Adult	0.19 (0.11-0.34)	<0.01
	Senior	0.06 (0.03-0.13)	<0.01

Variable	Category	Odds ratio (95% CI)	P
Species	Horses (Ref)
	Donkey or mule	2.94 (1.20-7.15)	0.02
Age range	Young (Ref)
	Adult	0.17 (0.10-0.30)	<0.001
	Senior	0.05 (0.02-0.10)	<0.001

Colégio Brasileiro de Parasitologia Veterinária FCAV/UNESP - Departamento de Patologia Veterinária, Via de acesso Prof. Paulo Donato Castellane s/n, Zona Rural, , 14884-900 Jaboticabal - SP, Brasil, Fone: (16) 3209-7100 RAMAL 7934 - Jaboticabal - SP - Brazil
E-mail: cbpv_rbpv.fcav@unesp.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] * Corresponding author: Alexandre Dias Munhoz. Universidade Estadual de Santa Cruz – UESC, Campus Soane Nazaré de Andrade, Rod. Jorge Amado, Km 16, Salobrinho, CEP 45662-900, Ilhéus, BA, Brasil. e-mail: munhoz@uesc.br