Occurrence of tick-borne pathogens in dogs in a coastal region of the state of Ceará, northeastern Brazil

Fonsêca, Arícia Débora Vasconcelos; Oliveira, Lorena Mayana Beserra de; Jorge, Felipe Rodrigues; Cavalcante, Ramuelly Olinda; Bevilaqua, Claudia Maria Leal; Pinto, Francisco José Maia; Santos, Jessica Maria Leite dos; Teixeira, Bruno Marques; Rodrigues, Ana Kétylla Ponte Prado; Braz, Gissandra Farias; Viana, Geysa Almeida; Costa, Edmara Chaves; Serpa, Maria Carolina de Azevedo; Weck, Bárbara Conte; Labruna, Marcelo Bahia

doi:10.1590/S1984-29612022010

Acessibilidade / Reportar erro

Brasil

Revista Brasileira de Parasitologia Veterinária

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original Article • Rev. Bras. Parasitol. Vet. 31 (1) • 2022 • https://doi.org/10.1590/S1984-29612022010 copy

Occurrence of tick-borne pathogens in dogs in a coastal region of the state of Ceará, northeastern Brazil

Ocorrência de patógenos transmitidos por carrapatos em cães em uma região litorânea do estado do Ceará, nordeste do Brasil

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

The aim of this study was to determine the occurrence of tick-borne pathogens (Ehrlichia canis, Babesia vogeli, Hepatozoon spp. and Rickettsia spp.) in dogs in Vila de Jericoacoara, coastal region of Ceará, Brazil. Blood samples were collected from 153 animals and analyzed using molecular and serological methods. Sixty animals were found to be infected or exposed to at least one of the pathogens studied. Babesia vogeli was the most prevalent pathogen (15%), followed by E. canis (13.7%) and Hepatozoon spp. (11.8%), which was identified as Hepatozoon canis through sequencing. Twenty dogs (13%) were seroreactive to Rickettsia spp. Rhipicephalus sanguineus sensu lato was observed on 11.8% of the animals. There were associations between age (< 3 years old) and positivity for B. vogeli, and between habitation (stray dogs) and positivity for H. canis. There were also associations between anemia and infection with H. canis, and between leukopenia and exposure to Rickettsia spp. No association was detected between clinical alterations and infection with or exposure to the pathogens studied. The results confirmed that pathogens of veterinary importance are circulating in northeastern Brazil and showed that dogs are exposed to Rickettsia species with zoonotic potential, thus indicating a need for vector control measures.

Keywords:
Babesia vogeli; Hepatozoon canis; Ehrlichia canis; Rickettsia spp.; epidemiology

Target agents (gene)	Primers	Primer sequences (5’-3’)	(Bp)	Reference
Ehrlichia canis	Dsb321	TTGCAAAATGATGTCTGAAGATATGAAACA	378	Doyle et al. (2005)Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE, Hegarty BC, et al. Detection of medically important Ehrlichia by quantitative multicolor TaqMan real-time polymerase chain reaction of the dsb gene. J Mol Diagn 2005; 7(4): 504-510. http://dx.doi.org/10.1016/S1525-1578(10)60581-8. PMid:16237220. http://dx.doi.org/10.1016/S1525-1578(10)...
(dsb gene)	Dsb671	GCTGCTCCACCAATAAATGTATCYCCTA
	probe	AGCTAGTGCTGCTTGGGCAACTTTGAGTGAA
Babesia vogeli	B.c hsp70-F	GTCATCACTGTGCCTGCGTACT	90	Peleg et al. (2010)Peleg O, Baneth G, Eyal O, Inbar J, Harrus S. Multiplex real-time qPCR for the detection of Ehrlichia canis and Babesia canis vogeli. Vet Parasitol 2010; 173(3-4): 292-299. http://dx.doi.org/10.1016/j.vetpar.2010.06.039. PMid:20674177. http://dx.doi.org/10.1016/j.vetpar.2010....
(hsp70 gene)	B.c hsp70-R	GCATGACGTTGAGACCGGCAAT
	probe	AGCGCCAGGCCACCAAGGACGCT
Hepatozoon spp.	HEP2-169	GGTAATTCTAGAGCTAATACATGAGC	574	Almeida et al. (2012)Almeida AP, Marcili A, Leite RC, Nieri-Bastos FA, Domingues LN, Martins JR, et al. Coxiella symbiont in the tick Ornithodoros rostratus (Acari: argasidae). Ticks Tick Borne Dis 2012; 3(4): 203-206. http://dx.doi.org/10.1016/j.ttbdis.2012.02.003. PMid:22480930. http://dx.doi.org/10.1016/j.ttbdis.2012....
(18S rRNA)	HEP2-718	ACAATAAAGTAAAAAACAYTTCAAAG

		Endpoint titers for rickettsial antigens
Animals	Rickettsia rickettsii	Rickettsia amblyommatis	Rickettsia bellii	Rickettsia felis	PHA
C-08	-	256	-	-	R. amblyommatis
C-09	-	2048	-	-	R. amblyommatis
C-10	256	256	128	-	-
C-12	256	256	-	-	-
C-24	-	512	-	-	R. amblyommatis
C-29	256	512	-	-	-
C-34	512	1024	-	-	-
C-39	-	64	-	-	-
C-40	-	64	-	-	-
C-60	-	64	-	-	-
C-62	-	1024	-	-	R. amblyommatis
C-63	-	128	-	-	-
C-64	-	256	-	-	R. amblyommatis
C-66	-	256	-	-	R. amblyommatis
C-70	-	256	-	-	R. amblyommatis
C-88	-	256	-	-	R. amblyommatis
C-94	-	1024	-	64	R. amblyommatis
C-118	-	256	-	-	R. amblyommatis
C-119	-	256	-	-	R. amblyommatis
C-134	-	64	-	-	-

Independet Variables	N° of dogs	Dependent Variables
		*Babesia vogeli*				*Ehrlichia canis*				Hepatozoon spp.				Rickettsia spp.
		Positive (%)	PR	p value		Positive (%)	PR	p value		Positive (%)	PR	p value		Positive (%)	PR	p value
		Positive (%)	(95%CI)	p value		Positive (%)	(CI 95%)	p value		Positive (%)	(CI 95%)	p value		Positive (%)	(CI 95%)	p value
Sex
Female	102	17	1.42	0.424	a	11	0.55	0.135	a	11	0.79	0.595	a	9	2.25	0.245	b
Female	102	(16.7)	(0.59; 3.37)	0.424	a	(10.8)	(0.25; 1.21)	0.135	a	(10.8)	(0.32; 1.91)	0.595	a	(8.8)	(0.50; 10.03)	0.245	b
Male	51	6				10				7				2
Male	51	(11.8)				(19.6)				(13.7)				(3.9)
Breed
Mixed	115	20	2.20	0.156	a	3	1,06	0,907	a	16	2.64	0.122	b	9	1.49	0.584	b
Mixed	115	(17.4)	(0.69; 7.00)	0.156	a	(7.9)	(0.42; 2.69)	0,907	a	(13.9)	(0.64; 10.97)	0.122	b	(7.8)	(0.34; 6.58)	0.584	b
Pure	38	3				20 (17.4)				2				2
Pure	38	(7.9)				20 (17.4)				(5.3)				(5.3)
Age
< 3 years	89	17	2.95	0.009	a	11	1.14	0.739	a	12	2,5	0.059	a	3	0.39	0.134	a
< 3 years	89	(23.0)	(1.23; 7.07)	0.009	a	(14.9)	(0.52; 2.53)	0.739	a	(16.2)	(0.92; 6.74)	0.059	a	(4.1)	(0.11; 1.41)	0.134	a
≥ 3 years	62	6				10				5				8
≥ 3 years	62	(7.8)				-13				(6.5)				(10.4)
Habitation
Stray dog	14	2	0.93	0.917	b	2	1.03	0.966	b	5	4	0.010	b	0	- (- ; -)	0,136	b
Stray dog	14	(14.3)	(0.24; 3.57)	0.917	b	(14.3)	(0.26; 4.0)	0.966	b	(35.7)	(1,7; 10.0)	0.010	b	(0.0)	- (- ; -)	0,136	b
Domiciled	137	21				19				12				11
Domiciled	137	(15.3)				(13.9)				(8.8)				(8.0)
Street access
Yes	113	17	0.90	0.814	a	15	0.96	0.925	b	13	1.04	0.948	b	8	1.27	0.745	b
Yes	113	(15.0)	(0.39; 2.12)	0.814	a	(13.3)	(0.37; 2.45)	0.925	b	(11.5)	(0.36; 2.98)	0.948	b	(7.1)	(0.28; 5.73)	0.745	b
No	36	6				5 (13.9)				4				2
No	36	(16.7)				5 (13.9)				(11.1)				(5.6)
Presence of ectoparasites
Yes	20	3	1.00	0.996	b	2	0.70	0.590		1	0.39	0.268	b	2	1,48	0.618	b
Yes	20	(15.0)	(0.33; 3.05)	0.996	b	(10.0)	(0.18; 2.78)	0.590		(5.0)	(0.06; 2.78)	0.268	b	(10.0)	(0.34; 6.35)	0.618	b
No	133	20				19				17				9
No	133	(15.0)				(14.3)				(12.8)				(6.8)

Dependent Variable	N° of dogs	Independent Variable
		*Babesia vogeli*				*Ehrlichia canis*				Hepatozoon spp.				Rickettsia spp.
		Positive (%)	PR	p value		Positive (%)	PR	p value		Positive (%)	PR	p value		Positive (%)	PR	p value
		Positive (%)	(CI 95%)	p value		Positive (%)	(CI 95%)	p value		Positive (%)	(CI 95%)	p value		Positive (%)	(CI 95%)	p value
Anemia
Yes	36	8	1.61	0.168	a	3	0.57	0.260	b	8	2.14	0.036	b	2	0.76	0.073	b
Yes	36	(34.8)	(0.84; 3.09)	0.168	a	(14.3)	(0.19; 1.70)	0.260	b	(44.4)	(1.16; 3.95)	0.036	b	(18.2)	(0.21; 2.75)	0.073	b
No	117	15				18				10				9
No	117	(65.2)				(85.7)				(55.6)				(81.2)
Hyperproteinemia
Yes	58	6	0.65	0.205	a	9	1.15	0.615	a	4	0.56	0.144	a	7	1.77	0.073	b
Yes	58	(26.1)	(0.32; 1.34)	0.205	a	(42.9)	(0.67; 1.98)	0.615	a	(22.2)	(0.23; 1.35)	0.144	a	(63.6)	(1.08; 2.91)	0.073	b
No	95	17				12				14				4
No	95	(73.9)				(57.1)				(77.8)				(36.4)
Leukopenia
Yes	5	1	1.41	0.761	b	0	0.00	0.220	b	2	5.00	0.099	b	2	8.61	0.033	b
Yes	5	(4.3)	(0.17; 12.08)	0.761	b	(0.0)	(- ; -)	0.220	b	(11.1)	(0.90; 27.93)	0.099	b	(18.2)	(1.60; 46.21)	0.033	b
No	148	22				21				16				9
No	148	(95.7)				(100.0)				(88.9)				(81.2)
Leukocytosis
Yes	47	3	0.39	0.052	a	3	0.43	0.079	a	5	0.89	0.773	b	3	0.88	0.795	b
Yes	47	(13.0)	(0.13; 1.14)	0.052	a	(14.3)	(0.15; 1.26)	0.079	a	(27.8)	(0.41; 1.96)	0.773	b	(27.3)	(0.33; 2.38)	0.795	b
No	106	20				18				13				8
No	106	(87.0)				(85.7)				(72.2)				(72.7)
Neutrophilia
Yes	28	3	0.68	0.464	b	2	0.48	0.231	b	3	0.90	0.847	b	1	0.48	0.376	b
Yes	28	(13.0)	(0.22; 2.06)	0.464	b	(9.5)	(0.12; 1.89)	0.231	b	(16.7)	(0.30; 2.68)	0.847	b	(9.1)	(0.07; 3.19)	0.376	b
No	125	20				19				15				10
No	125	(87.0)				(90.5)				(83.3)				(90.9)
Neutropenia
Yes	1	0	0.00	0.567	b	0	0.00	0.586	b	0	0.00	0.616	b	0	0.00	0.699	b
Yes	1	(0.0)	(- ; -)	0.567	b	(0.0)	(- ; -)	0.586	b	(0.0)	(- ; -)	0.616	b	(0.0)	(- ; -)	0.699	b
No	152	23				21				18				11
No	152	(100.0)				(100.0)				(100.0)				(100.0)
Monocytosis
Yes	30	2	0.40	0.122	b	2	0.45	0.178	b	1	0.26	0.071	b	2	0.92	0.901	b
Yes	30	(8.7)	(0.10; 1.58)	0.122	b	(9.5)	(0.12; 1.75)	0.178	b	(5.6)	(0.04; 1.79)	0.071	b	(18.2)	(0.25; 3.37)	0.901	b
No	123	21				19				17				9
No	123	(91.3)				(90.5)				(94.4)				(81.2)
Lymphocytosis
Yes	30	2	0.40	0.122	b	1	0.22	0.078	b	2	0.54	0.305	b	3	1.43	0.523	b
Yes	30	(8.7)	(0.10; 1.58)	0.122	b	(4.8)	(0.03; 1.51)	0.078	b	(11.1)	(0.14; 2.06)	0.305	b	(27.3)	(0.52; 3.99)	0.523	b
No	123	21				20				16				8
No	123	(91.3)				(95.2)				(88.9)				(72.7)
Lymphopenia
Yes	4	1	1.88	0.599	b	0	0.00	0.274	b	0	0.00	0.314	b	0	0.00	0.437	b
Yes	4	(4.3)	(0.20; 17.34)	0.599	b	(0.0)	(- ; -)	0.274	b	(0.0)	(- ; -)	0.314	b	(0.0)	(- ; -)	0.437	b
No	149	22				21				18				11
No	149	(95.7)				(100.0)				(100.0)				(100.0)
Eosinophilia
Yes	58	5	0.53	0.083	a	5	0.59	0.152	b	3	0.41	0.069	a	4	0.96	0.912	b
Yes	58	(21.7)	(0.24; 1.19)	0.083	a	(23.8)	(0.27; 13.1)	0.152	b	(16.7)	(0.14; 1.17)	0.069	a	(36.4)	(0.43; 2.15)	0.912	b
No	95	18				16				15				7
No	95	(78.3)				(76.2)				(83.3)				(63.6)
Thrombocytopenia
Yes	38	7	1.28	0.500	a	5	0.95	0.907	a	5	1.14	0.761	b	4	1.52	0.377	b
Yes	38	(30.4)	(0.64; 2.54)	0.500	a	(23.8)	(0.42; 2.16)	0.907	a	(27.8)	(0.51; 2.53)	0.761	b	(36.4)	(0.66; 3.50)	0.377	b
No	117	16				16				13				7
No	117	(69.6)				(76.2)				(72.2)				(63.6)
Thrombocytosis
Yes	2	0	0.00	0.418	b	0	0.00	0.441	b	0	0.00	0.478	b	0	0.00	0.584	b
Yes	2	(0.0)	(- ; -)	0.418	b	(0.0)	(- ; -)	0.441	b	(0.0)	(- ; -)	0.478	b	(0.0)	(- ; -)	0.584	b
No	151	23				21				18				11
No	151	(100.0)				(100.0)				(100.0)				(100.0)

Colégio Brasileiro de Parasitologia Veterinária FCAV/UNESP - Departamento de Patologia Veterinária, Via de acesso Prof. Paulo Donato Castellane s/n, Zona Rural, , 14884-900 Jaboticabal - SP, Brasil, Fone: (16) 3209-7100 RAMAL 7934 - Jaboticabal - SP - Brazil
E-mail: cbpv_rbpv.fcav@unesp.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author: Lorena Mayana Beserra de Oliveira. E-mail: lorena.mayana@uece.br