Blankaartia sinnamaryi (Trombidiformes: Trombiculidae) parasitando aves no sudeste do Brasil, e notas sobre a detecção de Rickettsia

Bassini-Silva, Ricardo; Jacinavicius, Fernando de Castro; Maturano, Ralph; Muñoz-Leal, Sebastián; Ochoa, Ronald; Bauchan, Gary; Labruna, Marcelo Bahia; Barros-Battesti, Darci Moraes

doi:10.1590/S1984-296120180057

Ricardo Bassini-Silva

Departamento de Medicina Veterinária Preventiva e Saúde Animal, Faculdade de Medicina Veterinária e Zootecnia – FMVZ, Universidade de São Paulo – USP, São Paulo, SP, Brasil

Fernando de Castro Jacinavicius

Departamento de Medicina Veterinária Preventiva e Saúde Animal, Faculdade de Medicina Veterinária e Zootecnia – FMVZ, Universidade de São Paulo – USP, São Paulo, SP, Brasil

Laboratório Especial de Coleções Zoológicas, Instituto Butantan, São Paulo, SP, Brasil

Ralph Maturano

Departamento de Zoologia, Instituto de Ciências Biológicas, Universidade Federal de Juiz de Fora, Juiz de Fora, MG, Brasil

Sebastián Muñoz-Leal

Departamento de Medicina Veterinária Preventiva e Saúde Animal, Faculdade de Medicina Veterinária e Zootecnia – FMVZ, Universidade de São Paulo – USP, São Paulo, SP, Brasil

Ronald Ochoa

Systematic Entomology Laboratory, United States Department of Agriculture, Agricultural Research Service, Beltsville, MD, USA

Gary Bauchan

Electron & Confocal Microscopy Unit, United States Department of Agriculture, Agriculture Research Service, Beltsville, MD, USA

Marcelo Bahia Labruna

Departamento de Medicina Veterinária Preventiva e Saúde Animal, Faculdade de Medicina Veterinária e Zootecnia – FMVZ, Universidade de São Paulo – USP, São Paulo, SP, Brasil

Darci Moraes Barros-Battesti ^** Corresponding author: Darci Moraes Barros-Battesti. Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Pualista – UNESP, Rua Castellane, s/n, Via de Acesso Professor Paulo Donato Castelane, Vila Industrial, CEP 14884-900, Jaboticabal, São Paulo, Brasil. e-mail: barros.battesti@gmail.com

Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias – UNESP, Jaboticabal, SP, Brasil

* Corresponding author: Darci Moraes Barros-Battesti. Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Pualista – UNESP, Rua Castellane, s/n, Via de Acesso Professor Paulo Donato Castelane, Vila Industrial, CEP 14884-900, Jaboticabal, São Paulo, Brasil. e-mail: barros.battesti@gmail.com

Host Family	Host Species	IBSP accession number	No. of B. sinnamaryi specimens collected (No. specimens tested by PCR)
Pipridae	Chiroxiphia caudata	12331	2 (2)
	Chiroxiphia caudata	12336	2 (2)
	Manacus manacus	12338	4 (2)
Thraupidae	Tachyphonus coronatus	12323A	10 (4)
	Tachyphonus coronatus	12343	7 (2)
	Tachyphonus coronatus	12340	4 (2)
	Tachyphonus coronatus	12342	4 (2)
	Tachyphonus coronatus	12351	2 (2)
Troglodytidae	Troglodytes musculus	12344A	20 (2)
	Troglodytes musculus	12345A	36 (16)
Turdidae	Turdus rufiventris	12350	2 (2)
Tyrannidae	Lathrotriccus euleri	12348	2 (2)
Total			95 (40)

Target	Genes	Names and DNA sequences (5'- 3') of the primers	Fragment size	Reference
Chiggers	18S	18S–1R: ATATTGGAGGGCAAGTCTGG	~650-bp	Otto and Wilson (2001) Otto JC, Wilson KJ. Assessment of the usefulness of ribosomal 18S and mitochondrial COI sequences in Prostigmata phylogeny. In: Proctor HC, Norton RA, Colloff MJ, editors. Acarology: Proceedings of the 10th International Congress. Melbourne: CSIRO Publishing; 2001. p. 100-109.
		18S-1R: TGGCATCGTTTATGGTTAG
	COI-1	CI-J-175I: GGWGCWCCWGAYATRGCWTTYCC	950-bp	Simon et al. (1994) Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 1994; 87(6): 651-701. http://dx.doi.org/10.1093/aesa/87.6.651. http://dx.doi.org/10.1093/aesa/87.6.651...
		CI-N-219I: GGWARAATTAAAATATAWACTTC
		772: TGATTTTTTGGTCACCCAGAAG	408-bp	Navajas et al. (1994) Navajas M, Gutierrez J, Bonato O, Bolland HR, Mapangou-Divassa S. Intraspecific diversity of the cassava green mite Mononychellus progressivus (Acari: Tetranychidae) using comparisons of mitochondrial and nuclear ribosomal DNA sequences and cross breeding. Exp Appl Acarol 1994; 18(6): 351-360. http://dx.doi.org/10.1007/BF00116316. PMid:7628252. http://dx.doi.org/10.1007/BF00116316 ...
		773: TACAGCTCCTATAGATAAAAC
Rickettsia spp.	gltA	CS 78 F: GCAAGTATCGGTGAGGATGTAAT	401-bp	Labruna et al. (2004) Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol 2004; 42(1): 90-98. http://dx.doi.org/10.1128/JCM.42.1.90-98.2004. PMid:14715737. http://dx.doi.org/10.1128/JCM.42.1.90-9...
Rickettsia spp.	gltA	CS 323 R: GCTTCCTTAAAATTCAATAAATCAGGAT	401-bp
		CS-239 F: GCTCTTCTCATCCTATGGCTATTAT	830-pb	Labruna et al. (2004) Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol 2004; 42(1): 90-98. http://dx.doi.org/10.1128/JCM.42.1.90-98.2004. PMid:14715737. http://dx.doi.org/10.1128/JCM.42.1.90-9...
		CS-1069 R: CAGGGTCTTCGTGCATTTCTT
	ompA ^* * Rickettsia of the Spotted Fever Group.	Rr 190.70 F: ATGGCGAATATTTCTCCAAAA	532-bp	Regnery et al. (1991) Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol 1991; 173(5): 1576-1589. http://dx.doi.org/10.1128/jb.173.5.1576-1589.1991. PMid:1671856. http://dx.doi.org/10.1128/jb.173.5.1576...
	ompA ^* * Rickettsia of the Spotted Fever Group.	Rr 190.701 R: GTTCCGTTAATGGCAGCATCT	532-bp
	ompB	120.M59 F: CCGCAGGGTTGGTAACTGC	862-bp	Roux and Raoult (2000) Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol 2000; 50(Pt 4): 1449-1455. http://dx.doi.org/10.1099/00207713-50-4-1449. PMid:10939649. http://dx.doi.org/10.1099/00207713-50-4...
		120-807 R: CCTTTTAGATTACCGCCTAA

[1] * Corresponding author: Darci Moraes Barros-Battesti. Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Pualista – UNESP, Rua Castellane, s/n, Via de Acesso Professor Paulo Donato Castelane, Vila Industrial, CEP 14884-900, Jaboticabal, São Paulo, Brasil. e-mail: barros.battesti@gmail.com

Brasil

Brasil

Blankaartia sinnamaryi (Trombidiformes: Trombiculidae) parasitando aves no sudeste do Brasil, e notas sobre a detecção de Rickettsia

Resumo