Could dysregulation of <i>RASSF1</i> expression be a mechanism of tumorigenesis in CTVT?

Canine transmissible venereal tumor (CTVT) is the oldest known somatic cell lineage. It is a transmissible cancer that propagates naturally in dogs and reportedly contains gene mutations. RASSF1 participates in DNA damage repair, and its downregulation, results in tumor progression. Hence, RASSF1 is a tumor suppressor gene. Its expression was quantified in tumors from seventeen animals and three cell cultures derived from tumors. In general, RASSF1 was underexpressed in 65%, and absent in 35% of tumor samples. Cells from tumor tissue cultures showed decreased expression of RASSF1 in 67% and elevated expression in 33% of samples tested. The tumor tissues showed significantly lower levels of RASSF1 expression compared to cultured cells. Previously we reported that both the tumor microenvironment and the host immune system appear to influence the tumorigenesis and stage of CTVT. This is the first article to demonstrate the expression of RASSF1 in CTVT. Decreased RASSF1 possibly helps tumor progression.

INDEX TERMS:
Dysregulation; RASSF1; tumorigenesis; canine transmissible venereal tumor; CTVT

Authorship

Haline B. Fêo ^**Corresponding author: halinebf@hotmail.com

Departamento de Clínica Veterinária, Faculdade de Medicina Veterinária e Zootecnia (FMVZ), Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Rua Prof. Doutor Valter Maurício Corrêa s/n, Botucatu, SP 18618-681, Brazil.Universidade Estadual PaulistaBrazilBotucatu, SP, BrazilDepartamento de Clínica Veterinária, Faculdade de Medicina Veterinária e Zootecnia (FMVZ), Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Rua Prof. Doutor Valter Maurício Corrêa s/n, Botucatu, SP 18618-681, Brazil.

https://orcid.org/0000-0002-1891-9248

Luis Mauricio M. Flórez

Grupo de Investigación en Patología Veterinaria, Facultad de Medicina Veterinaria y de Zootecnia, Universidad Nacional de Colombia, Cra 45, Ciudad Universitaria, Bogotá, Colombia.Universidad Nacional de ColombiaColombiaBogotá, Colombia Grupo de Investigación en Patología Veterinaria, Facultad de Medicina Veterinaria y de Zootecnia, Universidad Nacional de Colombia, Cra 45, Ciudad Universitaria, Bogotá, Colombia.

https://orcid.org/0000-0002-5198-7998

Ricardo S. Yamatogi

Departamento de Veterinária, Universidade Federal de Viçosa (UFV), Av. Peter Henry Rolfs s/n, Viçosa, MG 36570-900, Brazil.Universidade Federal de ViçosaBrazilViçosa, MG, Brazil Departamento de Veterinária, Universidade Federal de Viçosa (UFV), Av. Peter Henry Rolfs s/n, Viçosa, MG 36570-900, Brazil.

https://orcid.org/0000-0002-0068-4217

Anderson P. Duzanski

Departamento de Patologia, Faculdade de Medicina de Botucatu, Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Av. Prof. Montenegro s/n, Botucatu, SP 18618-687, Brazil.Universidade Estadual PaulistaBrazilBotucatu, SP, Brazil Departamento de Patologia, Faculdade de Medicina de Botucatu, Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Av. Prof. Montenegro s/n, Botucatu, SP 18618-687, Brazil.

https://orcid.org/0000-0002-0562-9401

João P. Araújo Junior

Laboratório de Virologia, Instituto de Biociências, Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Distrito de Rubião Júnior s/n, Botucatu, SP 18618-970, Brazil.Universidade Estadual PaulistaBrazilBotucatu, SP, Brazil Laboratório de Virologia, Instituto de Biociências, Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Distrito de Rubião Júnior s/n, Botucatu, SP 18618-970, Brazil.

https://orcid.org/0000-0002-9153-1485

Rogerio A. Oliveira

Departamento de Bioestatística, Instituto de Biociências, Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Rua Prof. Doutora Irina Delanova Gemtchujnicov s/n, Botucatu, SP 18618-693, Brazil.Universidade Estadual PaulistaBrazilBotucatu, SP, Brazil Departamento de Bioestatística, Instituto de Biociências, Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Rua Prof. Doutora Irina Delanova Gemtchujnicov s/n, Botucatu, SP 18618-693, Brazil.

https://orcid.org/0000-0002-7568-748X

Noeme S. Rocha

https://orcid.org/0000-0001-9676-116X

*Corresponding author: halinebf@hotmail.com

Conflict of interest statement.- The authors declare that there are no conflicts of interest.

SCIMAGO INSTITUTIONS RANKINGS

Figures | Tables

Figures (1)
Tables (2)

Thumbnail

Fig.1.
Graphic representation of the relative mRNA expression of RASSF1, showing a statistically significant difference between the levels of expression in tumor tissue samples and cell cultures derived from tumors (P<0.01).

Thumbnail

Table 1.
CTVT patients at the Veterinary Hospital included in the study and the numerical (QR) values related to the RT-qPCR analysis for the RASSF1 gene in CTVT tissue and cell culture samples

Thumbnail

Table 2.
Primer sequences of the genes analysed in the RT-qPCR

Fig.1. Graphic representation of the relative mRNA expression of RASSF1, showing a statistically significant difference between the levels of expression in tumor tissue samples and cell cultures derived from tumors (P<0.01).

Table 1. CTVT patients at the Veterinary Hospital included in the study and the numerical (QR) values related to the RT-qPCR analysis for the RASSF1 gene in CTVT tissue and cell culture samples

Sample	Sex	Age (years)	Breed	Location	RASSF1 (QR)
T1	M	9	Mixed	Penis	0.008
T2	F	9	Dachshund	Vagina	0.001
T3*	M	7	Mixed	Penis	0.002
T4	M	9	Mixed	Penis	0
T5	M	-	Mixed	Skin - penis	0
T6	M	10	Mixed	Penis	0
T7	M	-	Mixed	Penis	0
T8*	F	10	Mixed	Vagina	0.002
T9*	M	5	Mixed	Penis	0.005
T10	M	6	Mixed	Penis	0.001
T11	M	-	Mixed	Penis	0
T12	M	8	Poodle	Oral cavity	0.029
T13	M	10	Mixed	Penis	0.011
T14	M	10	Mixed	Penis	0.002
T15	M	16	Mixed	Skin - penis	0.001
T16	M	-	Bull Terrier	Penis	0
T17	M	-	Mixed	Penis	0.027
C1	N/A	N/A	N/A	N/A	0.098
C2	N/A	N/A	N/A	N/A	1.360
C3	N/A	N/A	N/A	N/A	0.038

* Tumor samples that were used to perform isolations for cell cultures; M = male, F = female, N/A = not applicable, T = tissue, C = cell; (-) Not specified by owner.

Table 2. Primer sequences of the genes analysed in the RT-qPCR

Gene	Sense (5’ → 3’)	Antisense (3’ → 5’)
RPS5*	GAGGCGTCAGGCTGTCGAT	AGCCAAATGGCCTGATTCAC
RPS1*	GGGTCCTCCAAGCCCTAGAG	CGGCCCCCATCTTGGT
ACTB*	GGCATCCTGACCCTCAAGTA	CTTCTCCATGTCGTCCCAGT
RASSF1	TGTCGGATGATGAACAGCCC	CCTGCCCAATGACAACCAAG

* Brinkhof et al. (2006)Brinkhof B., Spee B., Rothuizen J. & Penning L.C. 2006. Development and evaluation of canine reference genes for accurate quantification of gene expression. Anal. Biochem. 356(1):36-43. <https://dx.doi.org/10.1016/j.ab.2006.06.001> <PMid:16844072>
https://doi.org/10.1016/j.ab.2006.06.001... .

How to cite

copy

Colégio Brasileiro de Patologia Animal - CBPA Pesquisa Veterinária Brasileira, Caixa Postal 74.591, 23890-000 Rio de Janeiro, RJ, Brasil, Tel./Fax: (55 21) 2682-1081 - Rio de Janeiro - RJ - Brazil
E-mail: pvb@pvb.com.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas