Sphygmomanometers and thermometers as potential fomites of <i>Staphylococcus haemolyticus</i>: biofilm formation in the presence of antibiotics

Sued, Bruna Pinto Ribeiro; Pereira, Paula Marcele Afonso; Faria, Yuri Vieira; Ramos, Juliana Nunes; Binatti, Vanessa Batista; Santos, Kátia Regina Netto dos; Seabra, Sérgio Henrique; Hirata, Raphael; Vieira, Verônica Viana; Mattos-Guaraldi, Ana Luíza; Pereira, José Augusto Adler

doi:10.1590/0074-02760160381

Bruna Pinto Ribeiro Sued

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

Paula Marcele Afonso Pereira

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

Yuri Vieira Faria

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

Juliana Nunes Ramos

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

Fundação Oswaldo Cruz-Fiocruz, Instituto Oswaldo Cruz, Rio de Janeiro, RJ, Brasil

Vanessa Batista Binatti

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

Kátia Regina Netto dos Santos

Universidade Federal do Rio de Janeiro, Instituto de Microbiologia Paulo de Góes, Rio de Janeiro, RJ, Brasil

Sérgio Henrique Seabra

Centro Universitário Estadual da Zona Oeste, Laboratório de Tecnologia em Bioquímica e Microscopia, Rio de Janeiro, RJ, Brasil

Raphael Hirata Júnior

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

Verônica Viana Vieira

Fundação Oswaldo Cruz-Fiocruz, Instituto Nacional de Controle de Qualidade em Saúde, Rio de Janeiro, RJ, Brasil

Fundação Oswaldo Cruz-Fiocruz, Instituto Oswaldo Cruz, Rio de Janeiro, RJ, Brasil

Ana Luíza Mattos-Guaraldi ⁺+ Corresponding author: guaraldi@uerj.br

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

José Augusto Adler Pereira

Universidade do Estado do Rio de Janeiro, Faculdade de Ciências Médicas, Rio de Janeiro, RJ, Brasil

+ Corresponding author: guaraldi@uerj.br

AUTHORS’ CONTRIBUTION

BPRS and PMAP contributed equally with all experiments; VBB helped in phenotypic identification and antibiotic susceptibility testing; Prof VVV and JNR helped in determination of clonal distribution by Pulsed-field gel electrophoresis (PFGE); Prof KRNS helped in a multiplex PCR; Prof SHS and YVF helped in scanning electron microscopy (SEM); Prof RH Jr, Prof ALMG and Prof JAAP helped with all experiments and orientation.

Figures (2)
Tables (2)

Thumbnail

Fig. 1
: biofilm formation on polyurethane catheter surfaces by oxacillin-resistant Staphylococcus haemolyticus (ORSH) isolated from fomites, verified by (A-C) scanning electron microscopy (SEM) assays and the roll plate Maki technique (D). After 24 h of incubation, the ORSH 11SF/9E3/06 [pulsed-field gel electrophoresis (PFGE) type G2; icaAD-positive] strain isolated from a sphygmomanometer used in the neonatal intensive care unit-Pedro Ernesto University Hospital-University of the State of Rio de Janeiro (ICU-HUPE-UERJ) (A) and grown in the absence of antibiotics produced a large amount of mature biofilm characterised by hollow voids on the luminal surface of the indwelling medical device; (B) detailed bacterial microcolonies indicative of a biofilm-producing pathogen; (C) biofilm production on catheter surfaces in the presence of ¼ minimal inhibitory concentration (MIC) of vancomycin (VA); (D) the roll plate assay indicated viable ORSH cells were extensively adherent (> 106 CFU) to and able to multiply on polyurethane catheter surfaces.

Thumbnail

Fig. 2
: pulsed-field gel electrophoresis (PFGE) profile dendrogram of the SmaI-digested genomic DNA of six oxacillin-resistant Staphylococcus haemolyticus (ORSH) strains isolated from two fomites, specifically sphygmomanometers (SF) and thermometers (T), in the nosocomial environment of Pedro Ernesto University Hospital-University of the State of Rio de Janeiro (HUPE-UERJ), Rio de Janeiro, Brazil. Similarity percentages are identified on the dendrogram derived from the unweighted pair group method using arithmetic averages and based on Dice coefficients. Microorganisms showing a similarity coefficient ≥ 80% were considered genetically PFGE-related. Multi-drug resistant ORSH (MDR ORSH) strains isolated from fomites utilised in different hospital wards demonstrated the following PFGE types: G1 [coronary intensive care unit (ICU)], G2 (neonatal ICU), H (general ICU), I (general surgery), and J (general surgery and general ICU). Polymerase chain reaction (PCR) reactions for the mecA and icaAD genes: +, positive; -, negative; antimicrobial multiresistance profiles: I to IV.

Thumbnail

TABLE II
Microbiological and genetic properties of six Staphylococcus haemolyticus strains isolated from fomites, specifically sphygmomanometers (SF) and a thermometer (T), in the nosocomial environment of Pedro Ernesto University Hospital-University of the State of Rio de Janeiro (HUPE-UERJ), Rio de Janeiro, Brazil

Thumbnail

TABLE I
Polymerase chain reaction (PCR) primers used in this study to identify Staphylococcus haemolyticus (SH), S. epidermidis (SE) and S. aureus (SA) species and to determine methicillin resistance based on the presence of the mecA (MRS) and icaAD genes, which play significant roles in slime production and biofilm formation

Strains number and fomite	Hospital wards	PFGE types	mecA/icaAD genes	Antimicrobial multiresistance profiles*	MIC [µg/mL] (susceptibility)		Slime production on Congo Red Agar (CRA)		Adherence^# levels to abiotic surfaces

									Glass binding assays		Polystyrene binding assays

					OXA	VA	C	OXA/VA	C	OXA/VA	C	OXA/VA
11SF/9E3/06	Neonatal ICU	G₂	- / +	I OXA,FOX,CIP,CLI,E,GEN,STX and CAZ, IPM, MXF	32 (R)	1 (S)	+	+ / +	+++	+++ / +++	++	++ / ++
SF/4BCGII/06	General surgery	I	- / +	I OXA,FOX,CIP,CLI,E,GEN,STX and CAZ, IPM, MXF	1 (R)	1 (S)	-	- / -	+++	+++ / +++	+++	+++ / +++
1SF/1BCG III/06	General surgery	J	- / +	II OXA,FOX,CIP,CLI,E,GEN,STX and CAZ, IPM	32 (R)	1 (S)	+	+ / +	+++	+++ / +++	-	+ / ++
28SF/2E2/06	General ICU	J	+ / -	III OXA,FOX,CIP,CLI,E,GEN,STX and CAZ	256 (R)	1 (S)	-	- / -	+++	+++ / +++	+	+ / +
33SF/4E5/06	Coronary ICU	G₁	+ / -	III OXA,FOX,CIP,CLI,E,GEN,STX and CAZ	32 (R)	1 (S)	-	- / -	+	+++ / +	+	++ / +
27T/2BCG II/06	General ICU	H	- / +	IV OXA,FOX,CIP,CLI,E,GEN,STX	8 (R)	1 (S)	-	-/ -	+++	+++ / +++	++	++ / ++

Primers	Sequence of forward and reverse primers 5’→ 3’	Product size (bp)	References
SH1	GGTCGCTTAGTCGGAACAAT	285	Schuenck et al. (2008)
SH2	CACGAGCAATCTCATCACCT	285	Schuenck et al. (2008)
SE1	CAGTTAATCGGTATGAGAGC	218	Iorio et al. (2011)
SE2	CTGTAGAGTGACAGTTTCGGT	218	Iorio et al. (2011)
SA1	AATCCTTGTCGGTACACGATATTCTTCAGC	108	Pereira et al. (2010)
SA2	CGTAATGAGATTTCAGTAGATAATACAACA	108	Pereira et al. (2010)
MRS1	TAGAAATGACTGAACGTCCG	154	Santos et al. (1999)
MRS2	TTGCGATCAATGTTACCTAG	154	Santos et al. (1999)
icaAD 1	GACAAGAACTACTGCTGCGT	546	Jong-Hyun et al. (2008)
icaAD 2	TACCGTCATACCCCTTCTCTG	546	Jong-Hyun et al. (2008)

[1] + Corresponding author: guaraldi@uerj.br

Brasil

Brasil

Sphygmomanometers and thermometers as potential fomites of Staphylococcus haemolyticus: biofilm formation in the presence of antibiotics

BACKGROUND

OBJECTIVES

METHODS

FINDINGS

MAIN CONCLUSIONS