Molecular association of pathogenicity and resistance to multiple antimicrobials in <i>Acinetobacter baumannii</i> strains recovered from patients with diverse infectious diseases

França, Rafaela O.; Costa, Priscila S.; Milanez, Guilherme Luiz; Bomfim, Maria Rosa Q.; Gonçalves, Ricardo; Farias, Luiz M.; Nobre, Vandack; Santos, Simone G.

doi:10.5935/1676-2444.20180049

Acessibilidade / Reportar erro

Brasil

Jornal Brasileiro de Patologia e Medicina Laboratorial

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

LABORATORY MEDICINE, Original article • J. Bras. Patol. Med. Lab. 54 (5) • Set-Oct 2018 • https://doi.org/10.5935/1676-2444.20180049 copy

Molecular association of pathogenicity and resistance to multiple antimicrobials in Acinetobacter baumannii strains recovered from patients with diverse infectious diseases

Associação molecular de fatores de patogenicidade e resistência a múltiplos antimicrobianos em linhagens de Acinetobacter baumannii recuperados de pacientes com doenças infecciosas diversas

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

INTRODUCTION:

The success of Acinetobacter baumannii infections can be attributed to its various virulence factors and antimicrobial resistance mechanisms.

OBJECTIVE:

To evaluate the presence and correlation between different resistance and virulence factors in clinical A. baumannii strains.

METHODS:

Study conducted at a University Hospital in Belo Horizonte, Minas Gerais, Brazil. The confirmation of Acinetobacter baumannii-calcoaceticus complex was performed by detecting the bla_OXA-51 gene through the polymerase chain reaction (PCR), as well as the search for genes: bla_OXA-23, ₂₄, ₅₈, ₁₄₃, bla_VIM-1, csuE, ompA and ISAba1. Antimicrobials and metallo-betalactamase (MβL) expression were evaluated by E-test^®; and genetic diversity, by enterobacterial repetitive intergenic consensus (ERIC)-PCR. Biofilm formation was classified into four categories according to the mean optical density obtained.

RESULTS:

98.4% (61/62) of the strains were resistant to meropenem; 71%, to ceftazidime; and 61.3%, to ampicillin-sulbactam; while 98.4% were sensitive to polymyxin B; and 48.4%, to tigecycline. The production of MβL was detected in 95.2% of the strains. The bla_OXA-51 gene was detected in all strains tested; bla_VIM-1, in 83.9%; and ISAba1, in 90.3%. On the other hand, the csuE and ompA genes were present in 43.5% and 53.2% of the strains, respectively.

CONCLUSION:

There was a possible correlation between gentamicin resistant samples and those that were positive for the ompA gene. The csuE gene correlated positively with ISAba1.

Key words:
Acinetobacter baumannii; virulence factors; molecular epidemiology; cross infection

Genes	Resistance/virulence phenotype	Oligonucleotide sequence (5'-3')	Amplification conditions	Amplicon	Reference
bla _VIM-1	Metallo-betalactamases	CGAATGCGCAGCACCAG CTGGTGCTGCGCATTCG	Initial denaturation 94°C, 1 min, 30×: 94°C, 1 min; 55°C, 1 min; 72°C, 1 min. Final extension: 72°C, 6 min	390 bp	Yan et al. (2001)⁽¹³13 Yan JJ, Hsueh PR, Ko WC, et al. Metallo-beta-lactamases in clinical Pseudomonas isolates in Taiwan and identification of VIM-3, a novel variant of the VIM-2 enzyme. Antimicrob Agents Chemother. 2001; 45: 2224-28.⁾
bla _OXA-23	Oxacillinases	GATCGGATTGGAGAACCAGA ATTTCTGACCGCATTTCCAT	Initial denaturation 94°C, 5 min, 30×: 94°C, 1 min; 52°C, 1 min; 72°C, 1 min. Final extension: 72°C, 8 min	501 bp	Woodford et al. (2006)⁽¹⁴14 Woodford N, Fagan EJ, Ellington MJ. Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum (beta)-lactamases. J Antimicrob Chemother. 2006; 57: 154-55.⁾
bla _OXA-24	Oxacillinasess	GGTTAGTTGGCCCCCTTAAA AGTTGAGCGAAAAGGGGATT		246 bp
bla _OXA-51	Oxacillinases/ specie marker	TAATGCTTTGATCGGCCTTG ATTTCTGACCGCATTTCCAT		353 bp
bla _OXA-58	Oxacillinases	AAGTATTGGGGCTTGTGCTG CCCCTCTGCGCTCTACATAC		599 bp
bla _OXA-143	Oxacillinases	TGGCACTTTCAGCAGTTCCT TAATCTTGAGGGGGCCAACC	Initial denaturation 94°C, 5 min, 30×: 94°C, 25 sec; 52°C, 40 sec; 72°C, 50 sec. Final extension: 72°C, 6 min	149 bp	Higgins et al. (2010)⁽¹⁵15 Higgins PG, Lehmann M, Seifert H. Inclusion of OXA-143 primers in a multiplex polymerase chain reaction (PCR) for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2010; 35(3): 305-14.⁾
ISAba1	Modulation of the expression of resistance genes	CATTGGCATTAAACTGAGGAGA GACGAATACTATGACACATCTC	Initial denaturation 95°C, 5 min, 35×: 95°C, 45 sec; 56°C, 45 sec; 72°C, 3 min. Final extension: 72°C, 5 min	549 bp	Turton et al. (2006)⁽¹⁶16 Turton JF, Ward ME, Woodford N, et al. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol Lett. 2006; 258: 72-7.⁾
ompA	Apoptosis induction in epithelial cells	GATGGCGTAAATCGTGGTA CAACTTTAGCGATTTCTGG	Initial denaturation 94°C, 3 min, 30×: 94°C, 45 sec; 57ºC, 45 sec; 72°C, 1 min. Final extension: 72°C, 10 min	355 bp	Turton et al. (2007)⁽¹⁷17 Turton JF, Gabriel SN, Valderrey C, Kaufamann ME, Pitt TL. Use of sequence-based typing and multiplex PCR to identify clonal lineages of outbreak strains of Acinetobacter baumannii. Clin Microbiol Infect. 2007; 13: 807-15.⁾
csuE	Biofilm formation on abiotic surfaces	CTTTAGCAAACATGACCTACC TACACCCGGGTTAATCGT		702 bp

Genes					Phenotypic assays				Resistance profile
Variables	VIM1	ISAba1	csuE	ompA	4 h/37°C	24 h/37°C	24 h/25°C	48 h/25°C	Ampic	Gentam	Ceftaz	Tigec
ISAba1	0.31
csuE	-0.1	0.47
ompA	0.06	0.5	0.74
4 h/37°C	-0.38	0.04	0.38	0.11
24 h/37°C	0	-0.41	-0.52	-0.55	0.1
24 h/25°C	0.14	-0.12	-0.6	-0.52	0.03	0.61
48 h/25°C	0.19	-0.22	-0.63	-0.57	-0.12	0.58	0.6
Ampic	-0.05	-0.22	-0.11	-0.12	-0.03	0.02	-0.07	0.05
Gentam	-0.04	-0.35	-0.56	-0.38	-0.03	0.38	0.44	0.33	-0.05
Ceftaz	-0.12	0.15	0.63	0.41	0.32	-0.31	-0.23	-0.48	0.07	0.05
Tigec	-0.34	-0.29	-0.04	-0.32	-0.05	0.16	0.01	0.16	0.37	-0.04	0.05
Metal	0.27	0.12	0.09	0.22	0.05	0.25	0.19	0.18	-0.02	0.12	0.46	0.2

Genes					Phenotypic assays				Resistance profile
Variables	VIM 1	ISAba1	csuE	ompA	4 h/37°C	24 h/37°C	24 h/25°C	48 h/25°C	Ampic	Gentam	Ceftaz	Tigec
ISAba1	0.232
csuE	0.656	0.025
ompA	0.825	0.061	0
4 h/37°C	0.015	0.97	0.008	0.572
24 h/37°C	0.959	0.005	0	0	0.458
24 h/25°C	0.692	0.218	0	0.001	0.848	0
48 h/25°C	0.624	0.048	0	0.001	0.191	0	0
Ampic	0.499	0.048	0.588	0.413	0.315	0.611	0.187	0.586
Gentam	0.887	0.192	0.001	0.05	0.796	0.004	0.002	0.007	0.753
Ceftaz	0.561	0.729	0	0.04	0.049	0.021	0.044	0	0.845	0.59
Tigec	0.074	0.221	0.926	0.087	0.843	0.422	0.713	0.342	0.014	0.387	0.786
Metal	0.41	0.564	0.717	0.483	0.979	0.259	0.839	0.932	0.174	0.244	0.114	0.474

Sociedade Brasileira de Patologia Clínica, Rua Dois de Dezembro,78/909 - Catete, CEP: 22220-040v - Rio de Janeiro - RJ, Tel.: +55 21 - 3077-1400 / 3077-1408, Fax.: +55 21 - 2205-3386 - Rio de Janeiro - RJ - Brazil
E-mail: jbpml@sbpc.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] CORRESPONDING AUTHOR: Simone Gonçalves dos Santos, Laboratório de Microbiologia Oral e de Anaeróbios; Departamento de Microbiologia; Instituto de Ciências Biológicas; Universidade Federal de Minas Gerais, Avenida Presidente Antônio Carlos, 6.627, C.P. 486; Pampulha-Campus UFMG. CEP: 31270-901; Belo Horizonte-MG, Brasil, Phone: +55 (31) 3409-2743. e-mail: simonegsantos@icb.ufmg.br