Comparison of genotyping methods and toxin gene profiles of <i>Staphylococcus aureus</i> isolates from clinical specimens

Andrade-Figueiredo, Mariana; Luz, Ana Carolina de Oliveira; Mota Silveira Filho, Vladimir da; Leal-Balbino, Tereza Cristina

doi:10.1590/1678-4685-GMB-2022-0321

Acessibilidade / Reportar erro

Brasil

Genetics and Molecular Biology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Genetics of Microorganisms • Genet. Mol. Biol. 46 (4) • 2023 • https://doi.org/10.1590/1678-4685-GMB-2022-0321 copy

Comparison of genotyping methods and toxin gene profiles of Staphylococcus aureus isolates from clinical specimens

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

Staphylococcus aureus is a frequent cause of infections worldwide. Methicillin-resistant S. aureus (MRSA) is one of the main causes of Gram-positive infections, and methicillin-susceptible strains (MSSA) primarily colonize and infect community hosts. Multiple virulence factors are involved, with toxins playing a significant role in several diseases. In this study, we assess the prevalence of toxin genes in 89 S. aureus clinical isolates (31 MRSA and 58 MSSA). We evaluated the discriminatory power of the association of internal transcribed spacer-PCR (ITS-PCR) and 3’- end coa gene ( coa-PCR) when compared with other more commonly used and costly techniques. The isolates showed a high level of genetic diversity, and toxins were found in all the isolates. While most toxin classes displayed no statistically significant correlations and were equally distributed in isolates regardless of their resistance status, classic enterotoxins ( sea-see) showed a positive correlation with MSSA isolates. The combination of coa-PCR with ITS-PCR showed a discriminatory index of 0.84, discriminating 22 genotypes that agree with previously determined data by PFGE and MLST. This association between the two PCR-based methods suggests that they can be useful for an initial molecular epidemiological investigation of S. aureus in hospitals, providing significant information while requiring fewer resources.

Keywords:
Staphylococcus aureus ; MRSA; MSSA; genotyping; exotoxins

Toxin	Gene	Primer	Sequence (5’→ 3’)	Fragment size (pb)	Reference
SEA	sea	SEA-3b	CCTTTGGAAACGGTTAAAACG	127	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
SEA	sea	SEA-4b	TCTGAACCTTCCCATCAAAAAC	127
SEB	seb	SEB-1c	TCGCATCAAACTGACAAACG	477	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
SEB	seb	SEB-4b	GCAGGTACTCTATAAGTGCCTGC	477
SEC	sec	SEC-3b	CTCAAGAACTAGACATAAAAGCTAGG	271	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
SEC	sec	SEC-4b	TCAAAATCGGATTAACATTATCC	271
SED	sed	SED-3b	CTAGTTTGGTAATATCTCCTTTAAACG	319	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
SED	sed	SED-4b	TTAATGCTATATCTTATAGGGTAAACATC	319
SEE	see	SEE-3b	CAGTACCTATAGATAAAGTTAAAACAAGC	178	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
SEE	see	SEE-2c	TAACTTACCGTGGACCCTTC	178
TSST-1	tst	TST-3	AAGCCCTTTGTTGCTTGCG	445	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
TSST-1	tst	TST-6	ATCGAACTTTGGCCCATACTTT	445
ETA	eta	ETA-3b	CTAGTGCATTTGTTATTCAAGACG	119	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
ETA	eta	ETA-4b	TGCATTGACACCATAGTACTTATTC	119
ETB	etb	ETB-3b	ACGGCTATATACATTCAATTCAATG	262	Becker et al., 1998Becker K, Roth R and Peters G (1998) Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J Clin Microbiol 36:2548-2553.
ETB	etb	ETB-4b	AAAGTTATTCATTTAATGCACTGTCTC	262
SEG	seg	SEG-1	ACGTCTCCACCTGTTGAAGG	400	Rosec and Gigaud, 2002Rosec JP and Gigaud O (2002) Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int J Food Microbiol 25:61-70.
SEG	seg	SEG-2	TGAGCCAGTGTCTTGCTTTG	400
SEH	seh	SEH-1	TCACATCATATGCGAAAGCAG	357	Rosec and Gigaud, 2002Rosec JP and Gigaud O (2002) Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int J Food Microbiol 25:61-70.
SEH	seh	SEH-2	TAGCACCAATCACCCTTTCC	357
SEI	sei	SEI-1	GGTGATATTGGTGTAGGTAAC	454	Omoe et al., 2002Omoe K, Ishikawa M, Shimoda Y, Hu D, Ueda S and Shinagawa K (2002) Detection of seg, seh, and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus Isolates harboring seg, seh, or sei genes. J Clin Microbiol 40:857-862.
SEI	sei	SEI-2	ATCCATATTCTTTGCCTTTACCAG	454
SEJ	sej	SEJ-1	CAGCGATAGCAAAAATGAAACA	426	Rosec and Gigaud, 2002Rosec JP and Gigaud O (2002) Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int J Food Microbiol 25:61-70.
SEJ	sej	SEJ-2	TCTAGCGGAACAACAGTTCTGA	426
SEK	sek	SEK-1	CACAGCTACTAACGAATATC	378	Chiang et al., 2006Chiang Y, Chang L, Lin C, Yang C and Tsen H (2006) PCR primers for the detection of staphylococcal enterotoxins K, L, and M and survey of staphylococcal enterotoxin types in Staphylococcus aureus isolates from food poisoning cases in Taiwan. J Food Prot 69:1072-1079.
SEK	sek	SEK-2	TGGAATTTCTCAGACTCTAC	378
SEL	sel	SEL-1	CATACAGTCTTACTAACGG	275	Chiang et al., 2006Chiang Y, Chang L, Lin C, Yang C and Tsen H (2006) PCR primers for the detection of staphylococcal enterotoxins K, L, and M and survey of staphylococcal enterotoxin types in Staphylococcus aureus isolates from food poisoning cases in Taiwan. J Food Prot 69:1072-1079.
SEL	sel	SEL-2	TTTTCTGCTTTAGTAACACC	275
SEM	sem	SEM-1	CTTGTCCTGTTCCAGTATC	329	Chiang et al., 2006Chiang Y, Chang L, Lin C, Yang C and Tsen H (2006) PCR primers for the detection of staphylococcal enterotoxins K, L, and M and survey of staphylococcal enterotoxin types in Staphylococcus aureus isolates from food poisoning cases in Taiwan. J Food Prot 69:1072-1079.
SEM	sem	SEM-2	ATACGGTGGAGTTACATTAG	329
SEN	sen	SEN-1	ATTGTTCTACATAGCTGCAA	682	Blaiotta et al., 2004Blaiotta G, Ercolini D, Pennachia C, Fusco V, Casaburi A, Pepe O and Villani F (2004) PCR detection of staphylococcal enterotoxin genes in Staphylococcus spp. strains isolated from meat and dairy products. Evidence for new variants of seg and sei in S. aureus AB-8802. J Appl Microbiol 97:719-730.
SEN	sen	SEN-2	TTGAAAAAACTCTGCTCCCA	682
SEO	seo	SEO-1	AGTCAAGTGTAGACCCTATT	534	Blaiotta et al., 2004Blaiotta G, Ercolini D, Pennachia C, Fusco V, Casaburi A, Pepe O and Villani F (2004) PCR detection of staphylococcal enterotoxin genes in Staphylococcus spp. strains isolated from meat and dairy products. Evidence for new variants of seg and sei in S. aureus AB-8802. J Appl Microbiol 97:719-730.
SEO	seo	SEO-2	TATGCTCCGAATGAGAATGA	534

		Resistance status
Toxin total count	Pearson’s R	-0.182
Toxin total count	p-value	0.088
ET^a count	Pearson’s R	-0.078
ET^a count	p-value	0.468
TSST^b count	Pearson’s R	0.103
TSST^b count	p-value	0.339
Classic se^c count	Pearson’s R	-0.327
Classic se^c count	p-value	0.002 ^*
egc^d count	Pearson’s R	0.035
egc^d count	p-value	0.743
se^c count	Pearson’s R	-0.125
se^c count	p-value	0.242

C/R genotype	coa- PCR	ITS- PCR	Strain	OXA/ CFO^a	SCC mec	MLST	PFGE type	PFGE cluster	spa type	E/P Clone^b	ET^c		TSST^d	Classic se^e					egc^f					se				Toxin profile
C/R genotype	coa- PCR	ITS- PCR	Strain	OXA/ CFO^a	SCC mec	MLST	PFGE type	PFGE cluster	spa type	E/P Clone^b	eta	etb	tst	sea	seb	sec	sed	see	seg	sei	sem	sen	seo	seh	sej	sek	sel	Toxin profile
1	C5	R15	Sa88	S	-	ST15	55	-	t084	-	-	-	+	-	-	-	-	-	+	+	+	+	+	+	+	+	+	41
2	C1	R2	Sa22	R	III	ST239	3	A	t037	BEC	-	-	-	-	-	-	-	-	+	-	+	+	+	-	-	+	+	8
3	C1	R3	Sa68	S	-	ST25	26	-	t1102	-	-	-	-	-	+	-	-	-	+	+	+	+	+	-	+	+	-	30
	C1	R3	Sa65	S	-	ST30	65	H	t433	USA1100^j	-	-	-	-	-	-	-	-	+	+	+	+	+	+	-	+	+	24
	C1	R3	Sa73	R	III	ST239	11	B	t037	BEC	-	-	-	-	-	-	-	-	+	-	-	-	+	-	+	-	+	2
	C1	R3	Sa77	S	-	ST333	51	G	t279	-	-	-	-	-	-	-	-	-	+	+	+	-	-	-	+	-	+	11
	C1	R3	Sa74	S	-	ST718	68	-	t1442	-	-	-	-	-	-	-	-	-	+	-	-	-	+	-	+	-	+	2
	C1	R3	Sa75	S	-	ST718	69	-	t1442	-	-	-	-	-	-	-	-	-	+	-	-	-	+	-	+	+	+	3
4	C1	R4	Sa39	R	III	ST239	1	-	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C1	R4	Sa43	R	III	ST239	2	-	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	-	19
	C1	R4	Sa67	R	III	ST239	4	A	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	+	18
	C1	R4	Sa19	R	III	ST239	5	A	t037	BEC	-	-	-	-	-	-	-	-	+	-	+	+	+	-	-	+	-	7
	C1	R4	Sa31	R	III	ST239	6	A	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C1	R4	Sa47	R	III	ST239	7	A	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	+	20
	C1	R4	Sa48	R	III	ST239	7	A	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	-	19
	C1	R4	Sa20	R	III	ST239	8	A	t037	BEC	-	-	-	-	-	-	-	-	-	-	+	+	+	-	-	+	-	1
	C1	R4	Sa57	R	III	ST239	9	A	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	-	-	-	+	-	14
	C1	R4	Sa55	R	III	ST239	10	-	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	-	-	-	+	+	15
	C1	R4	Sa86	R	III	ST239	12	B	t037	BEC	-	-	-	+	-	-	-	-	+	-	+	+	+	+	+	-	+	33
	C1	R4	Sa63	R	III	ST239	13	B	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	+	20
	C1	R4	Sa66	R	III	ST239	14	B	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	-	19
	C1	R4	Sa07	R	III	ST239	15	B	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	+	18
	C1	R4	Sa18	R	III	ST239	15	B	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
	C1	R4	Sa53	R	III	ST239	16	B	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	-	-	16
	C1	R4	Sa36	R	III	ST239	17	-	t037	BEC	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C1	R4	Sa37	S	-	ST239	57	-	t037	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	+	20
	C1	R4	Sa52	S	-	ST239	58	-	t037	-	-	-	-	-	-	-	-	-	+	+	+	+	-	-	-	+	+	15
	C1	R4	Sa38	S	-	ST15	54	G	NTⁱ	-	-	-	-	-	-	-	-	-	+	-	+	+	+	-	+	+	+	9
	C1	R4	Sa17	S	-	ST333	50	G	NTⁱ	-	+	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	45
	C1	R4	Sa60	S	-	ST333	50	G	t084	-	-	-	-	-	-	-	-	-	+	+	+	-	+	-	+	-	-	12
	C1	R4	Sa06	S	-	ST333	53	G	t084	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	+	18
5	C1	R6	Sa46	S	-	ST101	31	-	t056	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	-	19
6	C1	R7	Sa26	S	-	ST1	35	E	t127	USA400^j	-	-	-	+	-	-	-	-	+	-	+	+	+	+	-	+	-	32
	C1	R7	Sa27	S	-	ST1	35	E	t127	USA400^j	-	-	-	+	-	-	-	-	+	-	+	+	+	-	-	+	+	31
	C1	R7	Sa16	S	-	ST1	36	E	t127	USA400^j	-	-	-	+	+	-	-	-	+	+	+	+	+	+	-	+	-	39
	C1	R7	Sa25	S	-	ST1	30	-	t2279	-	-	-	-	+	-	-	-	-	+	+	+	+	+	+	+	+	+	38
	C1	R7	Sa10	S	-	ST1	48	-	t2279	-	-	-	-	+	-	-	-	-	+	+	+	+	+	+	-	+	+	37
7	C1	R12	Sa83	S	-	ST333	52	G	t084	-	-	-	-	+	-	-	-	-	+	+	+	+	+	+	+	+	+	38
8	C1	R14	Sa85	S	-	ST2383^g	29	-	t2279	-	-	-	-	+	-	-	-	-	+	+	+	+	+	+	+	+	+	38
9	C2	R1	Sa81	R	II	ST105	25	-	t002	USA100	-	-	-	-	-	-	-	-	+	+	+	+	+	+	+	+	-	25
	C2	R1	Sa01	R	IV	ST2381^g	18	C	t002	USA800	-	-	-	-	-	-	-	-	+	-	-	-	+	+	+	+	+	4
	C2	R1	Sa41	R	IV	ST5	20	C	NTⁱ	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	-	19
	C2	R1	Sa58	R	IV	ST5	20	C	NTⁱ	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
	C2	R1	Sa59	R	IV	ST5	21	C	NTⁱ	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C2	R1	Sa82	R	IV	ST5	19	C	t002	USA800	-	-	+	-	-	-	-	-	+	+	+	+	+	+	+	+	+	41
	C2	R1	Sa54	R	IV	ST5	20	C	t002	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
	C2	R1	Sa79	R	IV	ST5	22	C	t002	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	+	18
	C2	R1	Sa30	R	IV	ST5	23	D	t002	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
	C2	R1	Sa33	R	IV	ST5	24	D	t002	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C2	R1	Sa69	R	IV	ST5	20	C	t267	USA800	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	+	20
	C2	R1	Sa76	R	IV	ST5	18	C	t6787	USA800	-	-	-	-	-	-	-	-	+	+	+	+	-	-	-	+	+	15
	C2	R1	Sa12	S	-	ST1635	40	F	t002	USA800^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	+	18
	C2	R1	Sa51	S	-	ST1635	40	F	t002	USA800^j	-	-	-	-	-	-	-	-	+	+	+	+	-	-	-	+	+	15
	C2	R1	Sa29	S	-	ST1635	41	F	t002	USA800^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
	C2	R1	Sa87	S	-	ST5	44	F	t002	USA800^j	-	-	+	+	-	+	-	-	+	+	+	+	+	+	+	+	+	44
	C2	R1	Sa80	S	-	ST5	27	-	t002	-	-	-	+	-	-	-	-	-	+	+	+	+	-	-	-	+	+	40
	C2	R1	Sa21	S	-	ST5	39	-	t002	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C2	R1	Sa05	S	-	ST5	45	-	t002	-	-	-	-	-	-	-	-	-	+	+	+	+	+	+	+	+	+	26
	C2	R1	Sa40	S	-	ST5	47	-	t002	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C2	R1	Sa13	S	-	ST5	42	F	t10548^h	USA800^j	-	-	-	-	+	-	-	-	+	+	+	+	+	-	-	+	+	29
	C2	R1	Sa23	S	-	ST5	40	F	t1277	USA800^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
	C2	R1	Sa71	S	-	ST5	43	F	t214	USA800^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C2	R1	Sa03	S	-	ST5	38	-	t2164	USA100^j	-	-	-	-	-	+	-	-	+	-	-	-	+	-	-	+	+	27
	C2	R1	Sa56	S	-	ST5	46	-	t306	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
	C2	R1	Sa11	S	-	ST5	49	-	t9734	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	+	18
10	C2	R11	Sa61	S	-	ST2382^g	37	-	t189	-	-	-	-	-	-	-	-	-	+	-	-	+	+	-	+	-	+	5
10	C2	R11	Sa64	S	-	ST2382^g	37	-	t189	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	-	-	16
11	C2	R2	Sa89	S	-	ST285	66	H	t021	USA1100^j	-	-	-	-	-	-	-	-	+	+	+	+	+	+	+	+	+	26
	C2	R2	Sa15	S	-	ST30	62	H	t021	USA1100^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	+	18
	C2	R2	Sa62	S	-	ST30	63	H	t318	USA1100^j	-	-	-	-	-	-	-	-	+	+	+	+	+	+	-	-	+	23
	C2	R2	Sa34	S	-	ST30	64	H	t318	USA1100^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C2	R2	Sa02	S	-	ST30	67	H	t318	USA1100^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	+	22
	C2	R2	Sa70	S	-	ST30	67	H	t318	USA1100^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	-	+	-	17
12	C2	R3	Sa04	S	-	NTⁱ	NTⁱ	NTⁱ	t10550^h	-	-	-	-	-	-	-	-	-	+	-	-	-	+	+	+	+	+	4
	C2	R3	Sa50	S	-	ST30	64	H	t1001	USA1100^j	-	-	-	+	-	-	-	-	+	+	+	+	+	-	+	-	-	35
	C2	R3	Sa35	S	-	ST30	65	H	t433	USA1100^j	-	-	-	+	-	-	-	-	+	+	+	+	+	-	+	-	+	36
	C2	R3	Sa42	S	-	ST30	65	H	t433	USA1100^j	-	-	-	+	-	-	-	-	+	+	+	+	+	-	+	-	-	35
13	C2	R5	Sa08	S	-	ST45	59	-	t10550^h	-	-	-	+	-	-	+	-	-	+	+	+	+	+	-	-	+	+	43
14	C2	R6	Sa09	S	-	NTⁱ	NTⁱ	NTⁱ	t037	-	-	-	-	-	-	-	-	-	+	+	+	-	+	-	+	+	+	13
15	C2	R8	Sa24	S	-	ST6	28	-	t701	-	-	-	-	+	-	-	-	-	+	+	+	+	+	-	-	+	-	34
16	C2	R9	Sa28	S	-	ST5	42	F	t10548^h	USA800^j	-	-	-	-	-	-	-	-	+	+	-	+	-	-	-	-	-	10
17	C2	R10	Sa32	S	-	ST45	61	-	t1646	USA600^j	-	-	+	-	-	+	-	-	+	+	+	+	+	-	-	-	+	42
18	C2	R13	Sa84	S	-	ST45	60	-	t065	-	-	-	-	-	-	+	-	-	+	+	+	+	+	+	+	+	+	28
19	C3	R4	Sa45	S	-	ST398	NTⁱ	NTⁱ	t1451	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	-	19
20	C4	R2	Sa49	S	-	ST97	33	E	t267	USA400^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	+	-	21
	C4	R2	Sa72	S	-	ST669	34	E	t359	USA400^j	-	-	-	-	-	-	-	-	+	-	+	-	+	+	+	-	-	6
	C4	R2	Sa78	S	-	ST97	56	-	t267	-	-	-	-	-	-	-	-	-	+	+	+	-	-	-	+	-	+	11
21	C4	R3	Sa14	S	-	ST120	70	-	t645	-	-	-	-	-	+	-	-	-	+	+	+	+	+	-	-	+	+	29
22	C4	R9	Sa44	S	-	ST97	32	E	t521	USA400^j	-	-	-	-	-	-	-	-	+	+	+	+	+	-	+	-	+	20
Total:											1	0	6	13	4	5	0	0	88	74	81	78	80	19	49	62	58

Sociedade Brasileira de Genética Rua Cap. Adelmio Norberto da Silva, 736, 14025-670 Ribeirão Preto SP Brazil, Tel.: (55 16) 3911-4130 / Fax.: (55 16) 3621-3552 - Ribeirão Preto - SP - Brazil
E-mail: editor@gmb.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Send correspondence to
Tereza Cristina Leal-Balbino. Fundação Oswaldo Cruz, Instituto Aggeu Magalhães (IAM), Departamento de Microbiologia, Av. Professor Moraes Rego, s/n, Cidade Universitária, 50740-465, Recife, PE, Brazil. E-mail: tereza.balbino@fiocruz.br