Unstable environment of coastal lagoons drives genetic variation in the amphipod <i>Quadrivisio lutzi</i>

Xavier, Mariana Sampaio; Paiva, Paulo Cesar; Weber, Laura Isabel

doi:10.1590/1678-4685-GMB-2023-0094

Acessibilidade / Reportar erro

Brasil

Genetics and Molecular Biology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Animal Genetics • Genet. Mol. Biol. 46 (4) • 2023 • https://doi.org/10.1590/1678-4685-GMB-2023-0094 copy

Unstable environment of coastal lagoons drives genetic variation in the amphipod Quadrivisio lutzi

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

The freshwater/brackish amphipod Quadrivisio lutzi inhabits coastal lagoons, highly unstable environments subject to sudden inflow of marine water. Our aim was to evaluate how the genetic composition varies in these populations. Brazilian populations were compared by 16S rRNA and COI gene sequences. The genetic structure of four Rio de Janeiro amphipod populations was evaluated during the period of 2011-2019 by COI. Rio de Janeiro population was compared with Alagoas and São Paulo populations, which was genetically distinct, at species level (16S, d > 7%; COI, d >14%). The genetic structure in Rio de Janeiro showed the Imboassica subpopulation as the most divergent (Imboassica & Carapebus, F _ST = 0.238), followed by Lagamar population (Lagamar & Carapebus, F _ST = 0.049). The geographic distance and urbanization around these lagoons explain the degree of genetic isolation of these amphipod subpopulations. Paulista and Carapebus populations were not structured. Temporal variation in haplotype number and frequency were evident in both populations that were evaluated (Carapebus and Imboassica). Changes in salinity and water volume variation at these lagoons may be responsible for the observed changes in genetic composition, which may be the results of genetic drift effects over temporally fluctuating size subpopulations, without loss of genetic diversity.

Keywords:
Crustacea; Maeridae; Brazil; population genetics; mtDNA

Locality	Coordinates	Collection date	Salinity (ppt)	Number of amphipods
Locality	Coordinates	Collection date	Salinity (ppt)	16S	COI
State of Alagoas
Roteiro lagoon, Barra de São Miguel	9º50’6”S; 35º55’19.2”W	August 27, 2021	0.2	1	4
Roteiro lagoon, Barra de São Miguel	9º50’6”S; 35º55’19.2”W	December 19, 2021	0.2	1	1
State of Rio de Janeiro
Lagamar outlet, Campos dos Goytacazes	22º3’35.1”S; 41º5’00.7”W	April 24, 2019	6.7	7	28
Paulista lagoon, Quissamã*	22°14’2.5”S; 41º32’40.4”W	April 1, 2014	0.6	10	23
Paulista lagoon, Quissamã*	22°14’2.5”S; 41º32’40.4”W	August 8, 2015	0.5	4	5
Carapebus lagoon, Carapebus*	22°14’11.9”S; 41º35’28.8”W	October 21, 2011	0.3	0	39
		November 1, 2013	0.6	0	4
		November 1, 2014	8.3	6	1
		August 11, 2015	9.3	9	28
		April 13, 2016	3.9	0	7
		April 24, 2019	4.5	9	41
Imboassica lagoon, Macaé	22º24’42.3”S; 41º49’48.5”W	March 7, 2016	0.3	3	36
Imboassica lagoon, Macaé	22º24’42.3”S; 41º49’48.5”W	July 2, 2018	0.5	3	19
State of São Paulo
Escuro River, Ubatuba	23º29’27”S; 45º05’50”W	December 19, 2020	2.1	2	0
Escuro River, Ubatuba	23º29’27”S; 45º05’50”W	February 12, 2022	0.6-3.4	2	0

Target gene	Primer sequence (5’-3’)	Expected size (bp)	Reference
COI	LCO1490: TAAACTTCAGGGTGACCAAAAAATCA	710	Folmer et al. (1994Folmer O, Black M, Hoeh W, Lutz R and Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotech 3:294-299.)
	HCO2198: GGTCAACAAATCATAAAGATATTGG	710
	QCOI-R1: TAGGTGCTGGAATAAAATAGGG	685	Weber, L.I. unpublished
	QCOI-F1: ACACTCTACCTTATTACCGGAT	655
	QCOI-R1: TAGGTGCTGGAATAAAATAGGG	655
	QCOI-F3: CGNATAGARCTTTTAGTCCC	485	Present study
	QCOI-R3: AGRGAGAGTAGAAGAAGTGT	485
	QCOI-F4: TGRGCAGGACTYCTRGGTAGATC	545
	QCOI-R5: ATRGCCCCTGCTAAKACRGG	545
16S	16sar: CGCCTGTTTATCAAAAACAT	515	Palumbi et al. (2002Palumbi SR, Martin AP, Romano S, McMillan WO, Stice L and Grabowski G (2002) The simple tool’s guide to PCR. 2nd edition. University of Hawaii, Honolulu, 45 p.)
	16sbr: CCGGTCTGAACTCAGATCACGT	515
	Q16s-F2: CGTACATAGTACCTGCCCAGTG	445	Present study
	Q16s-R3: GGATGAACAATCCCACTCTC	445	Present study

Population (N)	Lagamar	Paulista	Carapebus	Imboassica	Diversity Parameters
Population (N)	Lagamar	Paulista	Carapebus	Imboassica	NH	HD	ND
Lagamar (28)	***	0.00207	0.00198	0.00394	6	0.439	0.212 ± 0.154
Paulista* (28)	0.036	***	0.00175	0.00345	3	0.315	0.185 ± 0.140
Carapebus* (108)	0.049	0.000	***	0.00343	9	0.545	0.166 ± 0.126
Imboassica* (55)	0.231	0.163	0.238	***	10	0.705	0.376 ± 0.234

Population and Year (N)	Lagamar 2019	Paulista 2014/15	Carapebus 2011	Carapebus 2015	Carapebus 2019	Imboassica 2016	Imboassica 2018	Diversity parameters
Population and Year (N)	Lagamar 2019	Paulista 2014/15	Carapebus 2011	Carapebus 2015	Carapebus 2019	Imboassica 2016	Imboassica 2018	NH	HD	ND
Lagamar 2019 (28)	***	0.002	0.002	0.002	0.003	0.003	0.020	6	0.439	0.2115± 0.1536
Paulista 2014/15 (28)	0.036	***	0.001	0.001	0.002	0.003	0.019	3	0.315	0.1849± 0.1395
Carapebus 2011 (39)	0.027	0.014	***	0.001	0.002	0.003	0.019	2	0.157	0.0991 ± 0.0907
Carapebus 2015 (28)	0.009	0.024	0.000	***	0.002	0.003	0.020	4	0.221	0.097 ± 0.0904
Carapebus 2019 (41)	0.190	0.114	0.250	0.220	***	0.003	0.019	6	0.645	0.2024 ± 0.1471
Imboassica 2016 (36)	0.160	0.102	0.208	0.198	0.120	***	0.019	7	0.571	0.3466 ± 0.2215
Imboassica 2018 (19)	0.474	0.418	0.583	0.566	0.361	0.150	***	7	0.792	0.3543± 0.2339

Haplotypes	Population and Year (N)
	Carapebus lagoon			Imboassica lagoon
	2011 (39)	2015 (28)	2019 (41)	2016 (36)	2018 (19)
H1	0.820	0.741	0.317	0.697	0.157
H2	0	0	0.512	0	0
H3	0	0	0	0	0.474
H4	0.103	0.074	0.024	0	0
H5	0	0.037	0.049	0	0
H6	0	0	0	0.152	0.157
H7	0.077	0.037	0.049	0	0
H9	0	0	0.049	0	0
H11	0	0	0	0.030	0.053
H12	0	0	0	0.061	0
H15	0	0.037	0	0	0
H16	0	0.037	0	0	0
H17	0	0	0	0	0.053
H19	0	0.037	0	0	0
H25	0	0	0	0	0.053
H30	0	0	0	0.030	0
H31	0	0	0	0.030	0
H32	0	0	0	0	0.053

Sociedade Brasileira de Genética Rua Cap. Adelmio Norberto da Silva, 736, 14025-670 Ribeirão Preto SP Brazil, Tel.: (55 16) 3911-4130 / Fax.: (55 16) 3621-3552 - Ribeirão Preto - SP - Brazil
E-mail: editor@gmb.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Send correspondence to Mariana Sampaio Xavier. Universidade Federal do Rio de Janeiro (UFRJ), Instituto de Biodiversidade e Sustentabilidade (NUPEM), Laboratório de Biologia Molecular, Avenida São José do Barreto, 764, Barreto, 27965-045, Macaé, RJ, Brazil. E-mail: sx.mari@gmail.com.