Combinations of traditional kombucha tea with medicinal plant extracts for enhancement of beneficial substances and activation of apoptosis signaling pathways in colorectal cancer cells

KAEWKOD, Thida; SANGBOONRUANG, Sirikwan; KHACHA-ANANDA, Supakit; CHAROENRAK, Sonthirat; BOVONSOMBUT, Sakunnee; TRAGOOLPUA, Yingmanee

doi:10.1590/fst.107521

Acessibilidade / Reportar erro

Brasil

Food Science and Technology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original Article • Food Sci. Technol 42 • 2022 • https://doi.org/10.1590/fst.107521 copy

Combinations of traditional kombucha tea with medicinal plant extracts for enhancement of beneficial substances and activation of apoptosis signaling pathways in colorectal cancer cells

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

Traditional kombucha tea was prepared by black tea leaves before fermentation with symbiotic microorganisms for 15 days. In this study, kombucha was prepared through a combination with medicinal plant extracts of T. catappa (KT) and A. marmelos (KA) to enhance a number of beneficial aspects. The results revealed that the phenolics, flavonoids, antioxidants and six organic acids, namely glucuronic, gluconic, D-saccharic acid 1,4-lactone (DSL), acetic, ascorbic, and succinic acids, in kombucha combined with the medicinal plant extracts resulted in the production of substances with greater beneficial properties than traditional kombucha tea. The viability of colorectal cancer cells (Caco-2) after treatment with KT and KA was suppressed in a dose-dependent manner, while DNA fragmentation in Caco-2 cells was induced via the apoptosis mechanism. This process involved the apoptosis pathways related to the intrinsic apoptosis pathway, which was activated by KT and KA through the mitochondrial-dependent pathways including cytochrome c release and Bcl-2 suppression, and activation of caspases-9 and caspases-3. The findings of this study support the enhanced beneficial properties of traditional kombucha tea through a combination with medicinal plants. This outcome would also support the consideration of natural supplementary kombucha beverages as medicinal food products in the prevention of colorectal cancer.

Keywords:
anticancer activity; apoptosis; beneficial substances; medicinal plant extract; traditional kombucha tea

Genes	Sequence of PCR primers (5’–3’)	References
Bcl-2	Forward: GTCTGGGAATCGATCTGGAAATCC Reverse: TTTGAAACTTCCCAATGAATCAGGAG	Kim et al. (2011)Kim, S. K., Park, K. Y., Yoon, W. C., Park, S. H., Park, K. K., Yoo, D. H., & Choe, J. Y. (2011). Melittin enhances apoptosis through suppression of IL-6/sIL-6R complex-induced NF-κB and STAT3 activation and Bcl-2 expression for human fibroblast-like synoviocytes in rheumatoid arthritis. Joint, Bone, Spine, 78(5), 471-477. http://dx.doi.org/10.1016/j.jbspin.2011.01.004. PMid:21354845. http://dx.doi.org/10.1016/j.jbspin.2011....
cytochrome c	Forward: GAGCGGGAGTGTTCGTTGT Reverse: GTCTGCCCTTTCTTCCTTCT	Sun et al. (2012)Sun, K. W., Ma, Y. Y., Guan, T. P., Xia, Y. J., Shao, C. M., Chen, L. G., Ren, Y. J., Yao, H. B., Yang, Q., & He, X. J. (2012). Oridonin induces apoptosis in gastric cancer through Apaf-1, cytochrome c and caspase-3 signaling pathway. World Journal of Gastroenterology, 18(48), 7166-7174. http://dx.doi.org/10.3748/wjg.v18.i48.7166. PMid:23326121. http://dx.doi.org/10.3748/wjg.v18.i48.71...
caspase-8	Forward: GTGGAGGAAAGCAATCTGTC Reverse: TATTAGCCCTGCCTGGTGTCT	Ge et al. (2011)Ge, X., Luo, X., Chen, Y., Li, M., Jiang, S., & Wang, X. (2011). Rhein induces apoptosis of HCT-116 human colon cancer cells via activation of the intrinsic apoptotic pathway. African Journal of Biotechnology, 10(61), 13244-13251.
GAPDH	Forward: GAAGGTGAAGGTCGGAGTC Reverse: GAAGATGGTGATGGGATTTC	Sun et al. (2012)Sun, K. W., Ma, Y. Y., Guan, T. P., Xia, Y. J., Shao, C. M., Chen, L. G., Ren, Y. J., Yao, H. B., Yang, Q., & He, X. J. (2012). Oridonin induces apoptosis in gastric cancer through Apaf-1, cytochrome c and caspase-3 signaling pathway. World Journal of Gastroenterology, 18(48), 7166-7174. http://dx.doi.org/10.3748/wjg.v18.i48.7166. PMid:23326121. http://dx.doi.org/10.3748/wjg.v18.i48.71...

Samples	Color	pH ¹	Organic acid contents in kombucha (g/L) and medicinal plant (mg per g extract) ¹ 1 The results are presented as mean ± SD values of triplicate independent experiments. a,b The data of different superscript letters (a, b) show significantly different values of KT and KA when compared with KB (P <0.05).
Samples	Color	pH ¹	Glucuronic	Gluconic	DSL	Acetic	Ascorbic	Succinic
KB	Brown	2.70 ± 0.07	ND^a	13.57 ± 0.14^a	1.16 ± 0.18^a	0.15 ± 0.03^a	21.69 ± 0.39^a	0.89 ± 0.23^a
KT	Brown	2.75 ± 0.01	10.68 ± 2.59^b*	33.10 ± 2.64^b^* * The statistical data show the highest value in each sample (P <0.05). ND: Organic acid in the sample was not detected. Abbreviations are indicated as follows: kombucha prepared from black tea (KB), kombucha combined with T. catappa (KT), kombucha combined with A. marmelos (KA), T. catappa extract (TE), and A. marmelos extract (AE).	18.61 ± 1.08^b*	1.66 ± 0.15^b	31.88 ±3.24^b*	16.49 ± 0.40^b*
KA	Yellow brown	3.26 ± 0.02	5.54 ± 0.06^b	12.80 ± 0.35^a	3.46 ± 0.21^b	8.64 ± 0.24^b*	21.34 ± 0.86^a	12.98 ± 0.42^b
TE	Brown	-	23.08± 1.95	76.81 ± 4.79	228.65 ± 60.38	26.19 ± 1.66	48.43 ± 16.50	89.08 ± 11.54
AE	Yellow brown	-	5.29 ± 1.05	38.76 ± 1.96	ND	17.94 ± 0.67	ND	16.36 ± 1.06

Samples	Antioxidant activity, total phenolic and flavonoid contents ¹ 1 The results are presented as mean ± SD values of triplicate independent experiments. Abbreviations are indicated as follows: kombucha prepared from black tea (KB), kombucha combined with T. catappa (KT), kombucha combined with A. marmelos (KA), T. catappa extract (TE) and A. marmelos extract (AE). a,bThe data of different superscript letters (a, b) show significantly different values of KT and KA when compared with KB (P <0.05).
Samples	Antioxidant activity (mg GAE per mL kombucha or mg GAE per g extract)	Total phenolic content (mg GAE per mL kombucha or mg GAE per g extract)	Total flavonoid content (mg QUE per mL kombucha or mg QUE per g extract)
KB	0.38 ± 0.02^a	0.35 ± 0.01^a	0.02 ± 0.01^a
KT	7.23 ± 0.02^b*	37.55 ± 1.78^b*	4.19 ± 0.11^b^* * The statistical data show the highest value in each sample (P < 0.05).
KA	0.72 ± 0.00^b	23.15 ± 1.44^b	0.49 ± 0.03^b
TE	100.77 ± 1.28	56.01 ± 0.19	29.66 ± 0.50
AE	7.10 ± 0.09	5.91 ± 0.05	3.01 ± 0.21

Samples	50% inhibitory concentration (IC₅₀) of kombucha (%) and medicinal plants (mg/mL) ¹ 1 The results are presented as mean ± SD values of triplicate independent experiments. Abbreviations are indicated as follows: kombucha prepared from black tea (KB), kombucha combined with T. catappa (KT), kombucha combined with A. marmelos (KA), T. catappa extract (TE), and A. marmelos extract (AE). a,b The data of different superscript letters (a, b) reflect significantly different inhibitory concentration values of KT and KA when compared with KB (P <0.05).
KB	6.077 ± 0.222^a
KT	0.346 ± 0.008^b^* * The highest potential inhibition of the sample to suppress Caco-2 cells is indicative of a significant value (P <0.05).
KA	13.704 ± 1.336^b
TE	0.169 ± 0.010
AE	39.342 ± 8.773

Sociedade Brasileira de Ciência e Tecnologia de Alimentos Av. Brasil, 2880, Caixa Postal 271, 13001-970 Campinas SP - Brazil, Tel.: +55 19 3241.5793, Tel./Fax.: +55 19 3241.0527 - Campinas - SP - Brazil
E-mail: revista@sbcta.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author: yboony150@gmail.com; yingmanee.t@cmu.ac.th