DECREASED EXPRESSION OF MICRORNA-629 IN GASTRIC CANCER SAMPLES POTENTIATED BY THE VIRULENCE MARKER OF H. PYLORI, CAGA GENE

Diminuição da expressão do microRNA-629 em amostras de câncer gástrico potencializada pelo marcador de virulências do H. pylori, gene cagA

ABSTRACT

Background:

Helicobacter pylori (H. pylori) is a gram-negative bacterium associated with the etiology of several gastrointestinal tract pathologies, and cagA-positive (cagA+) strains are found in populations with gastric ulcers and precancerous lesions, inducing pro-inflammatory responses. The development of neoplasms is related to microRNA (miRNA) dysregulation, indicating highly expressed miRNA-629. The article aims to correlate the expression level of miRNA-629 with the presence of H. pylori and the pathogenicity marker cagA.

Methods:

203 gastric biopsy samples were evaluated from individuals with normal gastric tissue (n=60), gastritis (n=96), and gastric cancer (n=47) of both genders and over 18 years old. The samples were subdivided according to the presence or absence of H. pylori, detected by polymerase chain reaction (PCR). RNA was extracted using a commercial kit and quantified. Complementary DNA (cDNA) was synthesized using commercial kits, and the relative expression was calculated using the 2^-ΔΔCt method.

Results:

Individuals infected with H. pylori are nine times more likely to develop gastric cancer. Cancer patients appeared to have decreased expression of miRNA-629; however, the presence of the bacterium would not influence this reduction. Individuals in the cancer group showed lower miRNA-629 expression when cagA+; however, in the control group, the expression was higher when cagA+.

Conclusion:

H. pylori is a factor involved in the etiology and progression of gastric diseases. Reduction in miRNA-629 expression in cancer patients occurs independent of the presence of the bacterium, but when the cagA pathogenicity marker is present, it induces changes in the gene expression of the respective miRNA.

Keywords:
Helicobacter pylori; gastric diseases; microRNA; virulence factors; chronic gastritis; inflammation

RESUMO

Contexto:

Helicobacter pylori (H. pylori) é uma bactéria gram-negativa associada à etiologia de várias patologias do trato gastrointestinal, e cepas positivas para cagA (cagA+) são encontradas em populações com úlceras gástricas e lesões pré-cancerígenas, induzindo respostas pró-inflamatórias. O desenvolvimento de neoplasias está relacionado à desregulação do microRNA (miRNA), indicando miRNA-629 altamente expresso. O artigo tem como objetivo correlacionar o nível de expressão do miRNA-629 com a presença de H. pylori e o marcador de patogenicidade cagA.

Métodos:

Foram avaliadas 203 amostras de biópsia gástrica de indivíduos com tecido gástrico normal (n=60), gastrite (n=96) e câncer gástrico (n=47) de ambos os sexos e com mais de 18 anos. As amostras foram subdivididas de acordo com a presença ou ausência de H. pylori, detectado por reação em cadeia da polimerase (PCR). O RNA foi extraído usando um kit comercial e quantificado. O DNA complementar (cDNA) foi sintetizado usando kits comerciais, e a expressão relativa foi calculada usando o método 2-ΔΔCt.

Resultados:

Indivíduos infectados com H. pylori têm nove vezes mais chances de desenvolver câncer gástrico. Pacientes com câncer parecem ter diminuição da expressão do miRNA-629; no entanto, a presença da bactéria não influenciaria essa redução. Indivíduos no grupo do câncer apresentaram menor expressão do miRNA-629 quando cagA+; no entanto, no grupo controle, a expressão foi maior quando cagA+.

Conclusão:

H. pylori é um fator envolvido na etiologia e progressão das doenças gástricas. A redução na expressão do miRNA-629 em pacientes com câncer ocorre independentemente da presença da bactéria, mas quando o marcador de patogenicidade cagA está presente, induz mudanças na expressão gênica do respectivo miRNA.

Palavras-chave:
Helicobacter pylori; doenças gástricas; MicroRNA; fatores de virulência; gastrite crônica; inflamação

HIGHLIGHTS

•Gastric cancer is associated with a drastic decrease in the expression of miR-629, a mechanism that may affect gastric carcinogenesis.

•The H. pylori virulence marker, cagA gene, somehow appears to modulate the expression of miR-629.

•The cagA gene, is associated with an intense reduction in the expression of miR-629 in gastric cancer samples.

INTRODUCTION

Helicobacter pylori (H. pylori) is a gram-negative, flagellated, spiral-shaped bacterium that produces urease, proteases, and phospholipases, which degrade the glycoproteins present in the gastric mucosa. It is associated with the etiology of various gastrointestinal (GI) tract pathologies, including chronic gastritis, peptic ulcers, mucosa-associated lymphoid tissue (MALT), and gastric neoplasia. Recognized by the World Health Organization as a Group I carcinogen, H. pylori is directly linked to the development of gastric neoplasia^1-7.

With the need to detect bacterial strains associated with gastric diseases, pathogenicity markers are important to research. Early studies discovered that not all strains of H. pylori expressed the cagA protein, a product of the cag pathogenicity island (cagPAI), classified as a type IV secretion system. Translocated into gastric epithelial cells cagA is considered an oncoprotein and induces multiple signaling cascades^8-11.

Cancer is a generic term that characterizes a broad group of complex diseases causing cellular damage in different origins, involving genetic and epigenetic alterations. Its development can be induced by physical, chemical, or biological agents. Currently, gastric cancer is the fifth most common neoplasia and the leading cause of death in various countries in West Asia^12-20.

As mentioned before, for many years, it has been described that H. pylori infection can promote dysregulation in miRNAs expression, and this can influence the development of many gastric diseases, including gastric cancer^21-23.

In this context, this study focuses on miR-629, which is characterized as oncogenic genes; thus, its expression is usually increased in several types of cancer, including GC²⁴. Studies show that this miRNA can affect important processes in carcinogenesis, such as proliferation, migration, and apoptosis. Moreover, miR-629 is also playing an important role in lung, ovarian, pancreatic, renal, breast, osteosarcoma, and head and neck cancers^25-31.

Therefore, miR-629 appears to be involved in different types of cancer. However, the specific mechanisms by which H. pylori infection is related to changes in miR-629 expression in GC are still unclear. Besides, according to²³, CagA can be the main inducer of changes in expression of several cytokines in gastric cells, through the activation of NF-Kb. Thus, it would be very important to recognize the virulence factor of H. pylori that affects the expression level of miR-629 in GC samples.

Considering this scenario, this study aimed to correlated the expression level of miRNA-629 with the presence of H. pylori and the cagA pathogenicity marker in samples from patients with normal gastric mucosa, patients with gastritis, and patients with gastric cancer.

METHODS

Sample collection and inclusion criteria

We evaluated 203 gastric biopsy samples from dyspeptic patients of both genders and over 18 years old (113♀/90♂; mean age ± SD = 55±16.5 years). Among the 203 samples, 60 belonged to the control group (patients with intact gastric mucosa, without inflammatory process assessed by histology; 38♀/22♂; mean age ± SD = 56±16 years), 96 samples belonged to the gastritis group (53♀/43♂; mean age ± SD = 55±17 years), and 47 samples came from patients with gastric cancer group (22♀/25♂; mean age ± SD = 55±16 years). Patients who used antiparasitic and/or antibiotic and/or immunosuppressants and/or proton pump inhibitors treatments within the last 30 days were excluded from the study. Patients with infectious diseases were also excluded from the study.

The biopsies of fresh gastric tissues were also collected from antrum during endoscopic evaluation or gastric surgery in the Gastroenterology services of the Hospital Estadual de Bauru (HEB), Hospital das Clínicas de Marília, and Santa Casa de Marília. The samples from individuals with gastric cancer were obtained in collaboration with the Universidade Federal de São Paulo (UNIFESP) and Universidade Federal de Goiás (UFG).

After collection, all gastric tissue samples were stored in RNAlater (Ambion, Waltham, MA) according with manufacturer’s protocol, transported to laboratory and stored at -20º until use. The samples were subdivided into groups (control, gastritis, and gastric cancer) according to the histopathological analysis following the criteria of the updated Sydney System³² and Lauren System³³ and only diffuse gastric cancer samples were used. Subsequently, the groups were also divided according to the presence or absence of H. pylori according to the Polymerase Chain Reaction (PCR) result.

DNA extraction, H. pylori detection, and cagA Gene

DNA extraction was performed according to the protocol established by the QiAmp^® DNA Mini Kit from QIAGEN (Cat No. 51304). The PCR technique was employed to diagnose H. pylori and detect the cagA gene, as described in Table 1 ^34-35.

TABLE 1
PCR reactions conditions for H. pylori and cagA gene diagnosis.

Gene	Primer	Sequence (5’>3’)	Conditions	Amplicon
16SrRNA (H. pylori)	Hpx1	CTGGAGARACTAAGYCCTCC	40 cycles: 1 min 94 ºC, 1 min 59 ºC and 1 min 72 ºC	150 bp
	Hpx2	GAGGAATACTCATTGCGAAGGCGA
cagA	cagA1	ATGACTAACGAAACTATTGATC	40 cycles: 1 min 94 ºC, 1 min 53 ºC, and 1 min 72 ºC	232 bp
	cagA2	CAGGATTTTTGATCGCTTTATT

RNA extraction

For RNA extraction, approximately 40 mg of tissue was homogenized in a Precellys 24 tissue homogenizer (Bertin Corp., Rockville MD) and the total RNA was extracted using an miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The RNA samples were stored at 80°C and used for reverse transcription. RNA concentrations were measured and adjusted using the NanoDrop 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, United States) and only samples with a ratio value between 1.85 and 2.2 were used.

cDNA Synthesis and Real-Time Quantitative PCR (qPCR)

The complementary DNA (cDNA) synthesis from miRNA was performed using the TaqMan^® MicroRNA Reverse Transcription Kit (Applied Biosystems™, USA), following the manufacturer’s protocol.

The quantitative PCR (qPCR) reaction was carried out on the ABI Prism 7500 Fast Sequence Detection System, using TaqMan gene expression assay and specific probes. The relative quantification of expression was calculated using the 2^-ΔΔCt method, according to Livak and Schmittgen³⁶. The constitutive genes were evaluated and validated in previous studies³⁷. For miRNA, the hsa-miR-629-5p (478183 mir) assay was employed. The assays RNU6B (Hs001093) and RNU48 (Hs001006) (Applied Biosystems) were used as endogenous controls for the reactions.

Statistical analysis

Data were analyzed using GraphPad Prism 8 software. First, the results were analyzed using box-plot graphs to detect outliers. When necessary, the distribution was evaluated using the D’Agostino & Pearson tests. For the analysis of expression and association, the Wilcoxon Signed Rank, Kruskal-Wallis, Brown-Forsythe, Fisher’s exact, and chi-squared tests were used, depending on the groups analyzed. A level of P<0.05 was considered statistically significant.

Ethics approval

All the patients who participated received and signed a consent form to participate and the study was approved by the Ethics Committee (Case Number 1.119.830) of the Universidade do Sagrado (USC), Bauru, SP, Brazil.

RESULTS AND DISCUSSION

Detection of H. pylori

H. pylori was detected in 91/203 (45%) of the analyzed samples. The results indicate an association between the presence of the bacterium and the development of gastric diseases. The analyses performed in relation to the cagA gene involved 91 samples, of which 30 were positive, 3 belonging to the control group, 17 to the gastritis group and 10 gastric cancer samples, as shown in Table 2.

TABLE 2
Detection of H. pylori and cagA gene in gastric biopsy.

	Control n=60 (%)	Gastritis n=96 (%)	Gastric cancer n=47 (%)
H. pylori Pos	11 (18.3)	49 (51)	31 (65.9)
H. pylori Neg	49 (81.6)	47 (48.9)	16 (34)
OR (CI95%) P-valor	4.64 (2.180-9.948) <0.0001*1	1.858 (0.9041-3.861) 0.1082	8.63 (3.380-21.63) <0.0001*3
cagA Pos	3 (27.2)	17 (34.6)	10 (32.2)
cagA Neg	8 (72.7)	32 (65.3)	21 (677)
Total (n=91)	11	49	31

• *statistically significant. ¹Control group vs gastritis group; ²Gastritis group vs gastric cancer; ³Control group vs cancer group.

Marshall and Warren discovered the presence of H. pylori in gastric mucosa in 1983. These researchers obtained tissue samples from patients through endoscopy and found an association between the presence of the bacterium and the etiology of gastrointestinal diseases, such as chronic gastric inflammation³⁸.

Kawai et al.³⁹ showed that infected patients have an increased, cumulative risk of developing gastric cancer, depending on the presence or absence of the bacterium. The risk of developing the disease was calculated from birth to 85 years of age among H. pylori-positive patients, resulting in 22.26% (95%CI, 20.63-23.21) for men and 8.74% (95%CI, 8.07-9.14) for women. These results were similar to those found in our samples, indicating a higher incidence of H. pylori in patients diagnosed with cancer.

In a retrospective study, Ddine et al.⁴⁰ investigated factors associated with the diagnosis of chronic gastritis and the presence or absence of H. pylori and found similar results for the group of patients diagnosed with gastritis, with a higher incidence of the bacterium. The study included 94 patients with the disease, evaluated through digestive endoscopy to identify the causative agents of the pathology. The results elucidated that 56.6% (54 individuals) carried the bacterium as the etiological agent, while only 43.6% (40 individuals) did not present a specific agent.

Gastritis is considered the starting point for analyzing the changes caused by H. pylori in infected individuals. The inflammation is provoked by the activation of the immune system caused by the installation of the bacterium. In cases where treatment is not properly carried out, it can progress to precancerous lesions⁴¹.

Expression of miRNA-629

The obtained results about miRNA expresson, were realized in two stages. Initially, the values obtained between the control, gastritis, and cancer groups were analyzed without considering the presence of H. pylori. Subsequently, the groups were subdivided considering the presence and absence of the bacterium, and then they were subjected to new statistical tests for comparison. The results are showed in Figure 1.

FIGURE 1
Analysis of miRNA-629-5p expression in groups: control, gastritis, and gastric cancer regardless and considering the presence of H. pylori.

The expression of miRNA-629 was compared among the three studied groups (control, gastritis, and cancer). The results was statistically significant (P=0.036), with a progressive reduction in the expression of this miRNA in patients diagnosed with cancer compared to the other two groups. Furthermore, the analysis indicates no significant differences when performing paired comparisons between groups (control vs gastritis, gastritis vs cancer, and control vs cancer). subsequently, subgroups (negative control, positive control, negative gastritis, positive gastritis, negative cancer, and positive cancer) were compared, and the results showed that miRNA-629 expression did not present significant differences between groups, with or without H. pylori.

Shin et al.⁴² demonstrated the use of a platform to search for expressed miRNAs in the plasma of patients diagnosed with gastric cancer. After selection, they found that patients with a diagnosis of gastric neoplasia have a higher expression of miRNA-627, miRNA-629, and miRNA-652 than healthy individuals. This is the first study to demonstrate a ten-fold higher expression of miRNA-627 in patients diagnosed with gastric cancer, compared to individuals unaffected by diseases, warranting further detailed investigation in other tissues.

Another study by Hashemi et al.⁴³ linked the BCL2 rs1016860 gene with miRNA-629, concluding that this association could be a potent biomarker for gastric and breast cancer.

Li et al.⁴⁴ found that miRNA-629 promotes tumor cell invasion and endothelial cell permeability in lung cancer. Li et al.⁴⁵ found the same miRNA overexpressed in prostate cancer, suggesting that it contributed to tumor progression. In both cases, the miRNA played a role of an oncogene. In gastric cancer, the actual role of this gene remains unclear. According to our results, H. pylori does not influence its expression, whereas, in gastric cancer, it appears to down regulate, suggesting no relation to this specific condition.

miRNA-629 expression and cagA gene

As illustrated in Figure 2, two groups with statistically significant results (P<0.5) were observed: the control group (P=0.0364) and the cancer group (P=0.001). Individuals in the cancer group with a positive cagA gene presented lower expression of miRNA-629 than the same group with a negative cagA gene. Conversely, the control group had opposite results, demonstrating that individuals with a positive cagA gene had higher miRNA-629 expression than those with a negative cagA gene.

FIGURE 2
Analysis of miRNA-629 expression and cagA gene. *statistically significant.

Considering the association between cancer and the virulence marker, individuals with cagA+ exhibited lower miRNA-629 expression. This association, either alone or in conjunction with the disease, could be related to the presence of the positive cagA gene. The opposite was found in the control group, indicating that individuals with intact gastric mucosa and cagA+ had increased miRNA-629 expression.

The Gastritis group presented no statistically significant difference related to the presence or absence of the cagA gene, suggesting that the virulence marker does not modulate miRNA-629 expression when there is a gastric inflammatory process. This miRNA has been poorly studied, and this was the first study to investigate the correlation between miRNA-629 and H. pylori, more precisely, the cagA virulence marker.

Nguyen et al.⁴⁶ conclude that cagA carriers had a higher risk of ulcerations than patients with cagA- (OR:325/CI:1.37-17.71) / P=0.008). Their study involved 268 children diagnosed with H. pylori, of which 185 cases (69%) were found to have the presence of cagA virulence marker. Fraga et al.⁴⁷ evaluated 225 individuals diagnosed with chronic gastritis and peptic ulcers (gastric and duodenal) and found 141 (62.7%) cases of H. pylori infection. They concluded that the presence of cagA and babA2 genes and the combination of cagA/oipA genes increased the risk of developing gastric inflammation. Additionally, the cagA/iceA1 genes and the cagA/oipA combination increased the likelihood of individuals presenting lymphoid follicular hyperplasia.

Our results indicated that cagA negatively modulated the miRNA-629 expression. Considering that this happened in the Cancer group, the gastric environmental conditions may have resulted from the influence of cagA because this virulence marker has an oncogenic profile⁴⁸. Yang et al.⁴⁹ found that miRNA-233-3p expression was significantly increased in the presence of H. pylori and cagA+, but their results suggest that H. pylori infection induced miRNA-233 expression independently of the cagA gene. This miRNA showed significantly increased expression in cancerous gastric tissue cells, and its presence was significantly higher when the bacterium was detected. Therefore, we may conclude that cagA does not depend on miRNAs or work with them to establish a neoplastic process.

CONCLUSION

H. pylori is involved in the etiology and progression of gastric diseases. In this work, we found that miRNA-629 expression is reduced in gastric cancer patients, independent of the presence of the bacterium. On the other hand, the cagA gene appears to modulate the expression of miRNA-629 in both cancer and normal patients. In the Cancer group, individuals with the presence of the virulence marker exhibit lower expression of miRNA-629, whereas in the control group, we observed higher expression of this microRNA, suggesting that neoplastic transformation may also play a modulating role in the expression of this microRNA.

REFERENCES

• ¹
  World Gastroenterology Organisation Global Guideline: helicobacter pylori in developing countries. J Dig Dis. Sep 2011;12:319-26. Available from: https://doi.org/10.1111/j.1751-2980.2011.00529.x.
  » https://doi.org/10.1111/j.1751-2980.2011.00529.x
• ²
  Caleman Neto A, Rasmussen LT, de Labio RW, de Queiroz VF, Smith M, Viani GA, et al. Gene polymorphism of interleukin 1 and 8 in chronic gastritis patients infected with Helicobacter pylori J Venom Anim Toxins Incl Trop Dis. 2014;20:17. Available from: https://doi.org/10.1186/1678-9199-20-17.
  » https://doi.org/10.1186/1678-9199-20-17
• ³
  Shichijo S, Hirata Y, Niikura R, Hayakawa Y, Yamada A, Ushiku T, et al. Histologic intestinal metaplasia and endoscopic atrophy are predictors of gastric cancer development after Helicobacter pylori eradication. Gastrointest Endosc. 2016;84:618-24. Available from: https://doi.org/10.1016/j.gie.2016.03.791.
  » https://doi.org/10.1016/j.gie.2016.03.791
• ⁴
  Mesquita PM, Diogo Filho A, Jorge MT, Berbert AL, Mantese SA, Rodrigues JJ. Relationship of Helicobacter pylori seroprevalence with the occurrence and severity of psoriasis. An Bras Dermatol. 2017;92:52-7. Available from: https://doi.org/10.1590/abd1806-4841.20174880.
  » https://doi.org/10.1590/abd1806-4841.20174880
• ⁵
  Teixeira TF, De Souza IK, Rocha RD. Helicobacter pylori: infecção, diagnóstico laboratorial e tratamento. Percurso Acad. 2017;6:481. Available from: https://doi.org/10.5752/p.2236-0603.2016v6n12p481.
  » https://doi.org/10.5752/p.2236-0603.2016v6n12p481
• ⁶
  Camilo V, Sugiyama T, Touati E. Pathogenesis of Helicobacter pylori infection. Helicobacter. 2017;22:e12405. Available from: https://doi.org/10.1111/hel.12405.
  » https://doi.org/10.1111/hel.12405
• ⁷
  Ladeira MS, Salvadori DM, Rodrigues MA. Biopatologia do Helicobacter pylori J Bras Patol Medicina Lab. 2003;39:335-42. Available from: https://doi.org/10.1590/s1676-24442003000400011.
  » https://doi.org/10.1590/s1676-24442003000400011
• ⁸
  Ohnishi N, Yuasa H, Tanaka S, Sawa H, Miura M, Matsui A, et al. Transgenic expression of Helicobacter pylori CagA induces gastrointestinal and hematopoietic neoplasms in mouse. Proc National Acad Sci. 2008;105:1003-8. Available from: https://doi.org/10.1073/pnas.0711183105.
  » https://doi.org/10.1073/pnas.0711183105
• ⁹
  Nishikawa H, Hatakeyama M. Sequence polymorphism and intrinsic structural disorder as related to pathobiological performance of the Helicobacter pylori CagA oncoprotein. Toxins Apr. 2017;9:136. Available from: https://doi.org/10.3390/toxins9040136.
  » https://doi.org/10.3390/toxins9040136
• ¹⁰
  Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, et al. cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc National Acad Sci Dec 1996;93:14648-53. Available from: https://doi.org/10.1073/pnas.93.25.14648.
  » https://doi.org/10.1073/pnas.93.25.14648
• ¹¹
  Akopyants NS, Clifton SW, Kersulyte D, Crabtree JE, Youree BE, Reece CA, et al. Analyses of the cag pathogenicity island of Helicobacter pylori Mol Microbiol. 2002;28:37-53. Available from: https://doi.org/10.1046/j.1365-2958.1998.00770.x.
  » https://doi.org/10.1046/j.1365-2958.1998.00770.x
• ¹²
  Greaves M. Cancer causation: the Darwinian downside of past success? Lancet Oncol Apr. 2002;3:244-51. Available from: https://doi.org/10.1016/s1470-2045(02)00716-7.
  » https://doi.org/10.1016/s1470-2045(02)00716-7
• ¹³
  Pitot HC, Dragan YP, Teeguarden J, Hsia S, Campbell H. Quantitation of multistage carcinogenesis in rat liver. Toxicol Pathol. 1996;24:119-28. Available from: https://doi.org/10.1177/019262339602400116.
  » https://doi.org/10.1177/019262339602400116
• ¹⁴
  Feinberg AP, Cui H, Ohlsson R. DNA methylation and genomic imprinting: insights from cancer into epigenetic mechanisms. Semin Cancer Biol. 2002;12:389-98. Available from: https://doi.org/10.1016/s1044-579x(02)00059-7.
  » https://doi.org/10.1016/s1044-579x(02)00059-7
• ¹⁵
  Smiraglia DJ. Differential targets of CpG island hypermethylation in primary and metastatic head and neck squamous cell carcinoma (HNSCC). J Med Genet. 2003;40:25-33. Available from: https://doi.org/10.1136/jmg.40.1.25.
  » https://doi.org/10.1136/jmg.40.1.25
• ¹⁶
  Peduk S, Dincer M, Tatar C, Ozer B, Kocakusak A, Citlak G, et al. The role of serum ck-18, mmp-9 and tipm-1 levels in predicting R0 resection in patients with gastric cancer. ABCD Arq Bras Cir Dig. 2018;31. Available from: https://doi.org/10.1590/0102-672020180001e1401.
  » https://doi.org/10.1590/0102-672020180001e1401
• ¹⁷
  Figueroa-Giralt M, Csendes A, Carrillo K, Danilla S, Lanzarini E, Braghetto I, et al. Introduction of the new lymphoparietal index for gastric cancer patients. Arq Bras Cir Dig . 2019;32. Available from: https://doi.org/10.1590/0102-672020190001e1441.
  » https://doi.org/10.1590/0102-672020190001e1441
• ¹⁸
  Norero E, Quezada JL, Cerda J, Ceroni M, Martinez C, Mejía R, et al. Risk factors for severe postoperative complications after gastrectomy for gastric and esophagogastric junction cancers. Arq Bras Cir Dig . 2019;32. Available from: https://doi.org/10.1590/0102-672020190001e1473.
  » https://doi.org/10.1590/0102-672020190001e1473
• ¹⁹
  IARC Publications Website - Home. IARC publications website - Cancer today (powered by GLOBOCAN 2018). 2018. Available from: https://publications.iarc.fr/Databases/Iarc-Cancerbases/Cancer-Today-Powered-By-GLOBOCAN-2018--2018
  » https://publications.iarc.fr/Databases/Iarc-Cancerbases/Cancer-Today-Powered-By-GLOBOCAN-2018--2018
• ²⁰
  Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA. 2018;68:394-424. Available from: https://doi.org/10.3322/caac.21492.
  » https://doi.org/10.3322/caac.21492
• ²¹
  Wang J, Wang Q, Liu H, Hu B, Zhou W, Cheng Y. MicroRNA expression and its implication for the diagnosis and therapeutic strategies of gastric cancer. Cancer Lett. 2010;297:137-43. doi: 10.1016/j.canlet.2010.07.018.
  » https://doi.org/10.1016/j.canlet.2010.07.018
• ²²
  Rossi AF, Cadamuro AC, Biselli-Périco JM, Leite KR, Severino FE, Reis PP, et al. Interaction between inflammatory mediators and miRNAs in Helicobacter pylori infection. Cell Microbiol. 2016;18:1444-58. doi: 10.1111/cmi.12587.
  » https://doi.org/10.1111/cmi.12587
• ²³
  Dastmalchi N, Safaralizadeh R, Banan Khojasteh SM. The correlation between microRNAs and Helicobacter pylori in gastric cancer. Pathog Dis. 2019;77:ftz039. doi: 10.1093/femspd/ftz039.
  » https://doi.org/10.1093/femspd/ftz039
• ²⁴
  Li M, Wang Y, Liu X, Zhang Z, Wang L, Li Y. miR-629 targets FOXO3 to promote cell apoptosis in gastric cancer. Exp Ther Med. 2020;19:294-300. doi: 10.3892/etm.2019.8168.
  » https://doi.org/10.3892/etm.2019.8168
• ²⁵
  Glocker E, Lange C, Covacci A, Bereswill S, Kist M, Pahl HL. Proteins encoded by the cag pathogenicity island of Helicobacter pylori are required for NF-κb activation. Infect Immun. 1998;66:2346-8. Available from: https://doi.org/10.1128/iai.66.5.2346-2348.1998.
  » https://doi.org/10.1128/iai.66.5.2346-2348.1998
• ²⁶
  Yang L, Li Y, Cheng M, Huang D, Zheng J, Liu B, et al. A functional polymorphism at microRNA-629-binding site in the 3’-untranslated region of NBS1 gene confers an increased risk of lung cancer in Southern and Eastern Chinese population. Carcinogenesis. 2011;33:338-47. Available from: https://doi.org/10.1093/carcin/bgr272.
  » https://doi.org/10.1093/carcin/bgr272
• ²⁷
  Jingushi K, Ueda Y, Kitae K, Hase H, Egawa H, Ohshio I, et al. MiR-629 targets TRIM33 to promote TGFβ/Smad signaling and metastatic phenotypes in ccRCC. Mol Cancer Res. 2014;13:565-74. Available from: https://doi.org/10.1158/1541-7786.mcr-14-0300.
  » https://doi.org/10.1158/1541-7786.mcr-14-0300
• ²⁸
  Yan H, Li Q, Wu J, Hu W, Jiang J, Shi L, et al. MiR-629 promotes human pancreatic cancer progression by targeting FOXO3. Cell Death Amp Dis. 2017;8:e3154-e3154. Available from: https://doi.org/10.1038/cddis.2017.525.
  » https://doi.org/10.1038/cddis.2017.525
• ²⁹
  Phuah NH, Azmi MN, Awang K, Nagoor NH. Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1’S-1’-acetoxychavicol acetate via regulating RSU1. OncoTargets Ther. 2017;10:1695-705. Available from: https://doi.org/10.2147/ott.s117492.
  » https://doi.org/10.2147/ott.s117492
• ³⁰
  Li X, Li N, Niu Q, Zhu H, Wang Z, Hou Q. Elevated expression of mir-629 predicts a poor prognosis and promotes cell proliferation, migration, and invasion of osteosarcoma. OncoTargets Ther . 2020;13:1851-7. Available from: https://doi.org/10.2147/ott.s232479.
  » https://doi.org/10.2147/ott.s232479
• ³¹
  Tyczyńska M, Kędzierawski P, Karakuła K, Januszewski J, Kozak K, Sitarz M, et al. Treatment strategies of gastric cancer-molecular targets for anti-angiogenic therapy: a state-of-the-art review. J Gastrointest Cancer. 2021;52:476-88. Available from: https://doi.org/10.1007/s12029-021-00629-7.
  » https://doi.org/10.1007/s12029-021-00629-7
• ³²
  Stolte M, Meining A. The updated sydney system: classification and grading of gastritis as the basis of diagnosis and treatment. Can J Gastroenterol. 2001;15:591-8. Available from: https://doi.org/10.1155/2001/367832.
  » https://doi.org/10.1155/2001/367832
• ³³
  Hu B, El Hajj N, Sittler S, Lammert N, Barnes R, Meloni-Ehrig A. Gastric cancer: Classification, histology and application of molecular patho­logy. J Gastrointest Oncol. 2012;3:251-61. Available from: https://doi.org/10.3978/j.issn.2078-6891.2012.021.
  » https://doi.org/10.3978/j.issn.2078-6891.2012.021
• ³⁴
  Scholte GH, van Doorn LJ, Quint WG, Lindeman J. Polymerase chain reaction for the detection of Helicobacter pylori in formaldehyde-sublimate fixed, paraffin-embedded gastric biopsies. Diagn Mol Pathol. 1997;6:238-43. Available from: https://doi.org/10.1097/00019606-199708000-00008.
  » https://doi.org/10.1097/00019606-199708000-00008
• ³⁵
  Rasmussen LT, Labio RW, Gatti LL, Silva LC, Queiroz VF, Smith M de A, et al. Helicobacter pylori detection in gastric biopsies, saliva and dental plaque of Brazilian dyspeptic patients. Mem Inst Oswaldo Cruz. 2010;105:326-30. Available from: https://doi.org/10.1590/s0074-02762010000300015.
  » https://doi.org/10.1590/s0074-02762010000300015
• ³⁶
  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-8. Available from: https://doi.org/10.1006/meth.2001.1262.
  » https://doi.org/10.1006/meth.2001.1262
• ³⁷
  Zabaglia LM, Bartolomeu NC, dos Santos MP, Peruquetti RL, Chen E, Smith M de A, et al. Decreased MicroRNA miR-181c expression associated with gastric cancer. J Gastrointest Cancer . 2017;49:97-101. Available from: https://doi.org/10.1007/s12029-017-0042-7.
  » https://doi.org/10.1007/s12029-017-0042-7
• ³⁸
  Marshall B, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1984;323:1311-5. Available from: https://doi.org/10.1016/s0140-6736(84)91816-6.
  » https://doi.org/10.1016/s0140-6736(84)91816-6
• ³⁹
  Kawai S, Wang C, Lin Y, Sasakabe T, Okuda M, Kikuchi S. Lifetime incidence risk for gastric cancer in the Helicobacter pylori infected and uninfected population in Japan: A Monte Carlo simulation study. Int J Cancer. 2022;150:18-27. Available from: https://doi.org/10.1002/ijc.33773.
  » https://doi.org/10.1002/ijc.33773
• ⁴⁰
  Ddine LC, Ddine CC, Rodrigues CC, Kirsten VR, Colpo E. Fatores associados com a gastrite crônica em pacientes com presença ou ausência do Helicobacter pylori Arq Bras Cir Dig . 2012;25:96-100. Available from: https://doi.org/10.1590/s0102-67202012000200007.
  » https://doi.org/10.1590/s0102-67202012000200007
• ⁴¹
  Guimarães J, Corvelo TC, Barile KA. Helicobacter pylori: fatores relacionados à sua patogênese. Revista Paraense de Medicina. 2008;22:33-8.
• ⁴²
  Shin VY, Ng EK, Chan VW, Kwong A, Chu KM. A three-miRNA signature as promising non-invasive diagnostic marker for gastric cancer. Mol Cancer. 2015;14. Available from: https://doi.org/10.1186/s12943-015-0473-3.
  » https://doi.org/10.1186/s12943-015-0473-3
• ⁴³
  Hashemi Doulabi MS, Ghaedi K, Ranji N, Khazaei Koohpa Z. rs1016860 of BCL2 3’UTR associates with hsa-miR-629-5p binding potential in breast cancer and gastric cancer in Isfahan population. Gene. 2020;738:144457. Available from: https://doi.org/10.1016/j.gene.2020.144457.
  » https://doi.org/10.1016/j.gene.2020.144457
• ⁴⁴
  Li Y, Zhang H, Fan L, Mou J, Yin Y, Peng C, et al. MiR-629-5p promotes the invasion of lung adenocarcinoma via increasing both tumor cell invasion and endothelial cell permeability. Oncogene. 2020;39:3473-88. Available from: https://doi.org/10.1038/s41388-020-1228-1.
  » https://doi.org/10.1038/s41388-020-1228-1
• ⁴⁵
  Li Y, Zeng S, Cao L. MiR-629 repressed LATS2 expression and promoted the proliferation of prostate cancer cells. Horm Metab Res. 2023;55:573-9. Available from: https://doi.org/10.1055/a-2065-0954.
  » https://doi.org/10.1055/a-2065-0954
• ⁴⁶
  Nguyen TC, Tang NL, Le GK, Nguyen VT, Nguyen KH, Che TH, et al. Helicobacter pylori infection and peptic ulcer disease in symptomatic children in Southern Vietnam: a prospective multicenter study. Healthcare. 2023;11:1658. Available from: https://doi.org/10.3390/healthcare11111658.
  » https://doi.org/10.3390/healthcare11111658
• ⁴⁷
  Bustos-Fraga S, Salinas-Pinta M, Vicuña-Almeida Y, de Oliveira RB, Baldeón-Rojas L. Prevalence of Helicobacter pylori genotypes: cagA, vacA (m1), vacA (s1), babA2, dupA, iceA1, oipA and their association with gastrointestinal diseases. A cross-sectional study in Quito-Ecuador. BMC Gastroenterol. 2023;23. Available from: https://doi.org/10.1186/s12876-023-02838-9.
  » https://doi.org/10.1186/s12876-023-02838-9
• ⁴⁸
  Ahn HJ, Lee DS. Helicobacter pylori in gastric carcinogenesis. World J Gastrointest Oncol . 2015;7:455-65. Available from: https://doi.org/10.4251/wjgo.v7.i12.455.
  » https://doi.org/10.4251/wjgo.v7.i12.455
• ⁴⁹
  Yang F, Xu Y, Liu C, Ma C, Zou S, Xu X, et al. NF-κB/miR-223-3p/ARID1A axis is involved in Helicobacter pylori CagA-induced gastric carcinogenesis and progression. Cell Death Amp Dis . 2018;9. Available from: https://doi.org/10.1038/s41419-017-0020-9.
  » https://doi.org/10.1038/s41419-017-0020-9

• Disclosure of funding: this work was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) [Grant Nos: 2018/08481-1 and 2018/02008-2], and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001.

Publication Dates

• Publication in this collection
  20 May 2024
• Date of issue
  2024

History

• Received
  30 Oct 2023
• Accepted
  29 Feb 2024