Doenças infecciosas são as maiores responsáveis por falhas reprodutivas (FR) em cadelas, causando aborto, morte fetal e natimortalidade. Este estudo teve como objetivo investigar a associação entre agentes infecciosos, FR inexplicáveis e anemia em cadelas. Todas as amostras maternas e fetais foram negativas para a presença dos principais agentes infecciosos causadores de FR: herpes vírus canino 1, Neospora caninum, Brucella spp. e B. canis, enquanto agentes como o de Leishmania spp., parvovírus canino, Ehrlichia canis e Anaplasma platys foram encontrados em sangue materno. Coinfecções de A. platys/E. canis e A. platys/Leishmania spp. foram diagnosticadas. Os resultados indicam que os animais com anemia causadas por doenças transmitidas por vetores podem ser mais suscetíveis a sofrerem FR do que animais com valores hematológicos normais.

Palavras-chave:
Anaplasma; Ehrlichia; Leishmania; falhas reprodutivas

Autoria

D.A.C. Freire

Universidade Federal Rural do Semi-Árido -UFERSA/RN - Mossoró, RNUniversidade Federal Rural do Semi-ÁridoBrazilMossoró, RN, BrazilUniversidade Federal Rural do Semi-Árido -UFERSA/RN - Mossoró, RN

I.V.P.M. Oliveira

H.I.P. Ferreira

V.C.P. Andrade

UNESP - Universidade Estadual Paulista - Botucatu, SPUniversidade Estadual PaulistaBrazilBotucatu, SP, BrazilUNESP - Universidade Estadual Paulista - Botucatu, SP

C.R.F. Silva

UNESP - Universidade Estadual Paulista - Botucatu, SPUniversidade Estadual PaulistaBrazilBotucatu, SP, BrazilUNESP - Universidade Estadual Paulista - Botucatu, SP

J.K. Kurissio

IBTEC - Instituto de Biotecnologia - UNESP - Universidade Estadual Paulista - Botucatu, SPUniversidade Estadual PaulistaBrazilBotucatu, SP, BrazilIBTEC - Instituto de Biotecnologia - UNESP - Universidade Estadual Paulista - Botucatu, SP

L.S. Ullmann

C.D. Malossi

S.F. Joaquim

J.P. Araújo Júnior

H. Langoni

UNESP - Universidade Estadual Paulista - Botucatu, SPUniversidade Estadual PaulistaBrazilBotucatu, SP, BrazilUNESP - Universidade Estadual Paulista - Botucatu, SP

C. Calabuig

J. Megid

J.M.A.P. Antunes ^**Autor para correspondência (corresponding author) E-mail: joao.antunes@ufersa.edu.br

*Autor para correspondência (corresponding author) E-mail: joao.antunes@ufersa.edu.br

SCIMAGO INSTITUTIONS RANKINGS

UNESP - Universidade Estadual Paulista - Botucatu, SPUniversidade Estadual PaulistaBrazilBotucatu, SP, BrazilUNESP - Universidade Estadual Paulista - Botucatu, SP

Figuras | Tabelas

Figuras (1)
Tabelas (3)

Thumbnail

Figure 1
Reproductive failures (RF) in bitches due to anemia. Blood analysis comparing females that suffered of RF (unhealthy) and females that did not suffer of RF (healthy). A, Quantification of erythrocytes (mean ± standard error; in 1x106/mm3); B, Number for hemoglobin (mean ± standard error; in g/dL); C, Quantification of haematocrit (mean ± standard error; in %).

Thumbnail

Table 1
Molecular and serologic tests used for detection of pathogens in bitches

Thumbnail

Table 2
Results of molecular/serological tests, CBC and microscopy of bitches with reproductive problems

Thumbnail

Table 3
Post mortem exam of maternal/fetal tissues, fetuses, and gestational age of each female with reproductive disorders

Figure 1 Reproductive failures (RF) in bitches due to anemia. Blood analysis comparing females that suffered of RF (unhealthy) and females that did not suffer of RF (healthy). A, Quantification of erythrocytes (mean ± standard error; in 1x106/mm3); B, Number for hemoglobin (mean ± standard error; in g/dL); C, Quantification of haematocrit (mean ± standard error; in %).

Table 1 Molecular and serologic tests used for detection of pathogens in bitches

Molecular Test	Microorganism	Analyzed material	Sequence 5´ - 3´
qPCR*	Canid herpesvirus1	Blood, fetal fluid, pool of spleen+kidneys, pool of liver+lungs	ACAGAGTTGATTGATAGAAGAGGTATG
			CTGGTGTATTAAACT TTGAAGGCTTTA
			6-FAM- TCTCTGGGGTCTTCATCCTTAT CAAATGCG- BHQ1
PCR	Brucella spp.	Blood and placenta	ACATAGATCGCAGGCCAGTCA
			AGATACCGACGCAAACGCTAC
HRM-qPCR*	Ehrlichia spp. E. canis	Blood and pool of spleen+kidneys	CTCAGAACGAACGCTGG
			ACCATTTCTARTGCTATYCCRTACTA
qPCR	Anaplasma platys	Blood	TTTTTGTCGTAGCTTGCTATGATA
			TGTGGGTACCGTCATTATCTTCCCCA
qPCR	Neospora caninum	Blood and pool of spleen+kidneys	GTGAGAGGTGGGATACG
			GTCCGCTTGCTCCCTA
qPCR	Canine parvovirus	Blood and pool of spleen+kidneys	CAT TGG GCT TAC CAC CAT TT
			CCA ACC TCA GCT GGT CTC AT
PCR	Leishmania spp.	Blood	GGGTTGGTGTAAAATAGGG
			CAGAACGCCCCTACCCG

Serologic test	Microorganism	Analyzed material	Kits, antigen, and antibody
AGID*	Brucella canis	Serum	B. ovis Reo 198 surface antigen test kit (Tec-Par)
RBT*	Brucella abortus	Serum	B. abortus 1119-3 antigen (Biological Institute)
2ME-SAT*	Brucella abortus	Serum	B. abortus antigen (Tec-Par)
SAT*	Brucella abortus	Serum	B. abortus antigen (Tec-Par)
IFAT*	Leishmania major	Serum	anti IgG Leishmania major (Center of Zoonosis Control)

*qPCR, Real Time PCR for Canid herpesvirus1; HRM, High Resolution Melting for Ehrlichia spp. E. canis; AGID, Immunodiffusion agar gel for B. canis; RBT, Rose Bengal acidification test for B. abortus; SAT, Serum agglutination Test for B. abortus; 2ME, 2-mercaptoethanol for B. abortus; IFAT, Immunofluorescence Assay for L. major.

Table 2 Results of molecular/serological tests, CBC and microscopy of bitches with reproductive problems

Bitches	AGID B.canis	RBT B.abortus	2ME-SAT B.abortus	SAT B.abortus	IFAT L.major ^a	qPCR CaHV-1	PCR B.canis	PCR Parvovirus	PCR N.caninum	qPCR Leishmania spp.	HRM- qPCR E.canis	qPCR A.platys	Smear A.platys	A	T	CBC
B1	-	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-
B2	-	-	-	-	80	-	-	-	-	-	-	-	+	-	-	+
B3	-	+	-	-	-	-	-	-	-	-	+	-	+	+	-	+
B4	-	-	-	-	40	-	-	-	-	-	-	-	+	-	-	+
B5	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-
B6	-	-	-	-	40	-	-	-	-	-	-	-	+	+	+	+
B7	-	+	-	-	-	-	-	-	-	-	+	-	+	+	+	-
B8	-	+	-	-	-	-	-	-	-	-	-	-	-	+	-	-
B9	-	-	-	-	160	-	-	-	-	+	-	-	+	+	-	+
B10	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	+
B11	-	+	-	-	-	-	-	-	-	-	+	-	-	-	-	+
B12	-	-	-	-	-	-	-	-	-	-	-	-	+	+	-	+
B13	-	-	-	-	-	-	-	-	-	-	+	+	+	+	+	-
B14	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+
B15	-	-	-	-	-	-	-	-	-	-	-	-	+	+	-	+
B16	-	+	-	-	80	-	-	-	-	-	-	-	-	+	-	+
B17	-	+	-	-	-	-	-	-	-	-	-	-	-	+	-	+
B18	-	+	-	-	-	-	-	-	-	-	+	-	-	-	-	+
B19	-	-	-	-	-	-	-	-	-	-	-	+	-	-	+	-
B20	-	+	-	-	-	-	-	+	-	-	-	-	-	-	-	-

* AGID, Immunodiffusion agar gel for B. canis; RBT, Rose bengal acidification test for B. abortus; SAT, Serum agglutination test for B. abortus; 2ME, 2-mercaptoethanol for B. abortus; IFAT, Immunofluorescence assay for L. major, ^a Titration of antibodies; qPCR, Real Time PCR for CaHV-1, Leishmania spp., A.platys; HRM, High Resolution Melting for E.canis ; CBC, Complete blood count consistent with infection; CaHV-1, Canid herpesvirus 1; A, Anaemia; T, Thrombocytopenia

Table 3 Post mortem exam of maternal/fetal tissues, fetuses, and gestational age of each female with reproductive disorders

Animal^a	Fetuses	Uterus	Placenta	Fetal description	GA
C1	F1	Diffusely red mucosa	Blackened and green-yellow areas	Well-developed fetus	61
C2	F1/F2	Diffusely red mucosa	Blackened and green-yellow linear area	Autolysis	54
C3	F1/F2	Diffusely red mucosa	Autolysed	Autolysis	58
C4	F1	No alterations	Blackened placenta	No alterations	59
	F2		Blackened placenta	No alterations
	F3		Blackened placenta	Kidneys red with black dots
	F4		Blackened placenta	Distended gall bladder
	F5		Blackened placenta	No alterations
C6	F1	Diffusely red mucosa with blackened areas	Autolysed	Autolysis	60
C11	F1	No alterations	Autolysed	Heart with severe congestion	59
C11	F2	No alterations	Autolysed	Heart with severe congestion
C12	F1	No alterations	Thickened placenta	No alterations	47
	F2		Thickened placenta	No alterations
	F3			Acute and diffuse liver pallor
	F4		Thickened placenta	Diffuse purplish spots located in the anterior and posterior limbs, and in the left cervical region
C14	F1	Mucosa thickened and diffusely red	Autolysed	Autolysis	60
C15	F1	No alterations	Autolysed	Autolysis	60
C15	F2	No alterations	Autolysed	Autolysis
C16	F1	Diffusely red mucosa with blackened areas	Autolysed	Undergoing autolysis	55
C20	F1	Diffusely red mucosa with areas of greenish colour	Undergoing autolysis	Undergoing autolysis	54
	F2		Autolysis	Undergoing autolysis
	F3		Autolysis	Undergoing autolysis

^a
Female dogs (C5, C7, C8, C9, C10, C13, C17, C18, C19) had abortion episodes at home and the owners did not bring the fetuses to the Veterinary Hospital. GA: Gestational age in days

Como citar

copiar

Universidade Federal de Minas Gerais, Escola de Veterinária Caixa Postal 567, 30123-970 Belo Horizonte MG - Brazil, Tel.: (55 31) 3409-2041, Tel.: (55 31) 3409-2042 - Belo Horizonte - MG - Brazil
E-mail: abmvz.artigo@gmail.com

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Mensagem

[1] *Autor para correspondência (corresponding author) E-mail: joao.antunes@ufersa.edu.br